ID: 903063503

View in Genome Browser
Species Human (GRCh38)
Location 1:20685703-20685725
Sequence GTTCCCCGATGGTGTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903063492_903063503 12 Left 903063492 1:20685668-20685690 CCTCTCCTTTTGCTCCCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 359
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063497_903063503 -2 Left 903063497 1:20685682-20685704 CCCCTGGGGTGTTCAAATTGGGT 0: 1
1: 0
2: 2
3: 29
4: 167
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063499_903063503 -4 Left 903063499 1:20685684-20685706 CCTGGGGTGTTCAAATTGGGTTC 0: 1
1: 0
2: 0
3: 16
4: 66
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063494_903063503 7 Left 903063494 1:20685673-20685695 CCTTTTGCTCCCCTGGGGTGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063498_903063503 -3 Left 903063498 1:20685683-20685705 CCCTGGGGTGTTCAAATTGGGTT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903063503 Original CRISPR GTTCCCCGATGGTGTCATAG GGG Intronic