ID: 903063503

View in Genome Browser
Species Human (GRCh38)
Location 1:20685703-20685725
Sequence GTTCCCCGATGGTGTCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903063492_903063503 12 Left 903063492 1:20685668-20685690 CCTCTCCTTTTGCTCCCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 359
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063499_903063503 -4 Left 903063499 1:20685684-20685706 CCTGGGGTGTTCAAATTGGGTTC 0: 1
1: 0
2: 0
3: 16
4: 66
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063497_903063503 -2 Left 903063497 1:20685682-20685704 CCCCTGGGGTGTTCAAATTGGGT 0: 1
1: 0
2: 2
3: 29
4: 167
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063494_903063503 7 Left 903063494 1:20685673-20685695 CCTTTTGCTCCCCTGGGGTGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37
903063498_903063503 -3 Left 903063498 1:20685683-20685705 CCCTGGGGTGTTCAAATTGGGTT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG 0: 1
1: 0
2: 1
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903063503 Original CRISPR GTTCCCCGATGGTGTCATAG GGG Intronic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
906022821 1:42646153-42646175 GTTCCAAAATGGTGGCATAGAGG + Exonic
914215998 1:145629062-145629084 GTTCCAAGATGGTGGCGTAGGGG + Intronic
914468565 1:147951694-147951716 GTTCCAAGATGGTGGCGTAGGGG + Intronic
915599586 1:156913907-156913929 GGTCCCGGATGGTGGCATATGGG - Exonic
917135450 1:171784455-171784477 GTCCCGCGATGGTTTCACAGTGG - Exonic
924438113 1:244063496-244063518 GTTCTCTGATGGTGTCAAAGAGG + Intergenic
924919509 1:248612973-248612995 TTTCCCCGATGTTGTTAGAGAGG + Intergenic
1092850024 12:12618382-12618404 GATCCCAGATGGGGTCATGGTGG + Intronic
1098584194 12:72136989-72137011 GTTGCCCTATGATGTCACAGTGG - Intronic
1109381095 13:61559954-61559976 ATTCCCTGAGGGTCTCATAGAGG - Intergenic
1115910761 14:38254898-38254920 GCTCCCTGATGGGGTGATAGTGG + Exonic
1136293157 16:29287844-29287866 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1142099041 16:88261851-88261873 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1145272482 17:21412261-21412283 CTGCCCAGATGGTGTCATACAGG - Intronic
1145310690 17:21699724-21699746 CTGCCCAGATGGTGTCATACAGG - Intronic
1149461026 17:56830548-56830570 GTTCCCCAATGTTGTCCAAGGGG - Intronic
1153961476 18:10143645-10143667 GATCCCTGATGCTGTCATGGAGG + Intergenic
1159854085 18:73563604-73563626 GTTCCCCAAATCTGTCATAGTGG + Intergenic
929111473 2:38408595-38408617 GCTCCCCGATGTTGGCATAGGGG - Intergenic
947563093 2:231175260-231175282 ACTCCCAGATGGTGTCATTGTGG + Intergenic
1171444699 20:25195460-25195482 GTTCCCCGAGCGTCTCATGGCGG - Intergenic
1173663920 20:44752222-44752244 GTTCCCCTATGGTGTCTCCGAGG - Exonic
1176840761 21:13841323-13841345 GTTCCCTGATGCTGTGGTAGAGG - Intergenic
1182545822 22:31075922-31075944 GGTCCCCCATGGTCTCATATTGG - Intronic
1182845906 22:33430755-33430777 GTTCACAGATGGGGTCAGAGTGG - Intronic
963889735 3:150620309-150620331 GGTACCCGATGGTGGCATTGTGG + Intronic
967166561 3:186784456-186784478 GGACCCCGATGGTGTCATCGAGG + Exonic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
979633785 4:122933919-122933941 GTCTCCAGATGGTGTTATAGGGG + Intronic
993901551 5:93587598-93587620 GTTCCCCCGTGGTGGCTTAGGGG + Intronic
1002781828 6:372919-372941 GTTCCCCGGTACTGTCATTGCGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1012521869 6:100130958-100130980 GTTCACTGATGGTCTGATAGAGG + Intergenic
1019515001 7:1435605-1435627 GCTCCCAGAGGGTCTCATAGAGG + Intronic
1028631380 7:92938160-92938182 GTTCCCTGTTGGTGACATATAGG - Intergenic
1036282589 8:7414542-7414564 GTTCCCTCATGGAATCATAGTGG - Intergenic
1036338883 8:7897007-7897029 GTTCCCTCATGGAATCATAGTGG + Intergenic
1038646703 8:29367902-29367924 ATTCCCCGATGGTGGCATTATGG - Intergenic
1062261507 9:135665370-135665392 GGTCCCCGAGGGGGTCAGAGGGG - Intronic
1203778510 EBV:87671-87693 GTACGACGATGATGTCATAGAGG + Intergenic
1199962561 X:152789351-152789373 GTTGACTGCTGGTGTCATAGCGG + Intergenic