ID: 903065163

View in Genome Browser
Species Human (GRCh38)
Location 1:20695616-20695638
Sequence CTGGTAAGTCACAGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 235}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903065154_903065163 -7 Left 903065154 1:20695600-20695622 CCCCCACATCCCCTGCCTGGTAA 0: 1
1: 1
2: 2
3: 26
4: 288
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065151_903065163 -1 Left 903065151 1:20695594-20695616 CCTCTCCCCCCACATCCCCTGCC 0: 1
1: 0
2: 18
3: 331
4: 4775
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065149_903065163 3 Left 903065149 1:20695590-20695612 CCCTCCTCTCCCCCCACATCCCC 0: 1
1: 1
2: 33
3: 485
4: 5744
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065156_903065163 -9 Left 903065156 1:20695602-20695624 CCCACATCCCCTGCCTGGTAAGT 0: 1
1: 0
2: 4
3: 13
4: 201
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065148_903065163 7 Left 903065148 1:20695586-20695608 CCAACCCTCCTCTCCCCCCACAT 0: 1
1: 0
2: 4
3: 114
4: 1351
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065150_903065163 2 Left 903065150 1:20695591-20695613 CCTCCTCTCCCCCCACATCCCCT 0: 1
1: 2
2: 18
3: 454
4: 5094
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065157_903065163 -10 Left 903065157 1:20695603-20695625 CCACATCCCCTGCCTGGTAAGTC 0: 1
1: 0
2: 4
3: 12
4: 217
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065144_903065163 29 Left 903065144 1:20695564-20695586 CCTACCCTTTAGCTCTGTCTTCC 0: 1
1: 0
2: 1
3: 32
4: 368
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065147_903065163 8 Left 903065147 1:20695585-20695607 CCCAACCCTCCTCTCCCCCCACA 0: 1
1: 0
2: 3
3: 119
4: 1245
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065146_903065163 24 Left 903065146 1:20695569-20695591 CCTTTAGCTCTGTCTTCCCAACC 0: 1
1: 0
2: 0
3: 24
4: 302
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065155_903065163 -8 Left 903065155 1:20695601-20695623 CCCCACATCCCCTGCCTGGTAAG 0: 1
1: 0
2: 0
3: 31
4: 216
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065145_903065163 25 Left 903065145 1:20695568-20695590 CCCTTTAGCTCTGTCTTCCCAAC 0: 1
1: 0
2: 0
3: 32
4: 330
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235
903065153_903065163 -6 Left 903065153 1:20695599-20695621 CCCCCCACATCCCCTGCCTGGTA 0: 1
1: 0
2: 1
3: 40
4: 471
Right 903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG 0: 1
1: 0
2: 3
3: 29
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903065163 Original CRISPR CTGGTAAGTCACAGAGAACA GGG Intronic
900251291 1:1671489-1671511 CTGGTGAGTCACAGAGAAGGTGG - Exonic
900308437 1:2022165-2022187 CTGGTATGTCACGGAGACCTCGG - Intronic
901608854 1:10480891-10480913 GTGGTAAGTTACAGACATCAAGG + Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
903019907 1:20386717-20386739 CTAGTAAGGCACAGACAGCATGG + Intergenic
903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG + Intronic
903219461 1:21860865-21860887 CTAGTAAGTCCCACAGACCAGGG - Intronic
903384050 1:22915332-22915354 CTTGGAACTTACAGAGAACAGGG - Intergenic
906293220 1:44633098-44633120 CTGGTAAGTGAGAGAGGCCATGG + Intronic
907444411 1:54498839-54498861 CTGGCCAGTGACAGAGAACCTGG + Intergenic
907949367 1:59166492-59166514 CTGGCAAGTTGCAGAGAAAAAGG - Intergenic
908365230 1:63415395-63415417 ATGGTAAATCATAAAGAACAAGG - Intronic
908405782 1:63812898-63812920 CTGGTAAGGCATTGAGCACAGGG + Intronic
909052746 1:70786587-70786609 TTCGTAGGTCACACAGAACATGG - Intergenic
909884008 1:80917488-80917510 CTGGAGAGTAACAGAGAATAAGG - Intergenic
910244544 1:85124473-85124495 CTGTTAAGTTTCAGAGAACAAGG - Intronic
910965531 1:92804390-92804412 CTGGGAAGACACACAGAAAAAGG + Intergenic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
915584058 1:156834192-156834214 CGGGGAAGCCACAGAGACCAAGG + Intronic
916556171 1:165896125-165896147 CTAGCAAGGGACAGAGAACAAGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
921603079 1:217127596-217127618 GTGGTAAGTAACTGAGAACATGG + Intronic
922417697 1:225436563-225436585 CTGGTAAGTGACACAGAACAGGG - Intergenic
922754995 1:228090785-228090807 CTGGTCTGTCACTGAGCACAAGG - Intronic
923058411 1:230447701-230447723 CTGACAAGGCACTGAGAACACGG - Intergenic
923347693 1:233071779-233071801 CTGGGAAGTTGCAGAGAAAAAGG - Intronic
924271028 1:242332924-242332946 CAGGTACCTCACAGGGAACAAGG + Intronic
924453758 1:244201566-244201588 CAGTTGAGTCACAAAGAACACGG + Intergenic
1063251450 10:4279496-4279518 CTGAAAAATCACAGACAACAGGG + Intergenic
1064986812 10:21218707-21218729 CTGGGAGGTCACAGAAAAGAAGG + Intergenic
1068100045 10:52541417-52541439 CAGGAAAGGCACAGAGAGCAAGG + Intergenic
1068274908 10:54781999-54782021 CTTGTAAGTCTCAGAGATAAGGG + Intronic
1071573504 10:86710576-86710598 CTGGCATGACACAGAGAAGATGG - Intronic
1072317493 10:94216767-94216789 CTGAGAAGTCACAGAGAATGTGG - Intronic
1073349987 10:102812830-102812852 CTGGTAGGTCAGAGGGATCAGGG - Exonic
1075099416 10:119495629-119495651 CTGCAAAGTCACAGAAGACAAGG + Intergenic
1076204314 10:128583240-128583262 CTGGTAAGGCTAAGAGCACAGGG - Intergenic
1076207424 10:128614258-128614280 ATGGTAAGTCCCAGAGAACAGGG + Intergenic
1077725945 11:4675133-4675155 CTGGGAAGTCAGAGAGACCTGGG + Intergenic
1080001446 11:27355011-27355033 CTTGGTAGTCACACAGAACAAGG - Intronic
1080094284 11:28386397-28386419 ATGGTAATTAAAAGAGAACAGGG + Intergenic
1080260587 11:30345534-30345556 CTGAGAAGTCACAGTGAAGAAGG + Intergenic
1080439708 11:32280919-32280941 ATGGTAAAGCACAGAGCACAGGG - Intergenic
1080890358 11:36403751-36403773 CTGGTAAGTCACTTAGTAAAAGG - Intronic
1081228643 11:40557047-40557069 CAGCTAAGTCTCAGAGCACATGG - Intronic
1082960356 11:58913556-58913578 CTGGTATGTCACAGGCACCAAGG + Intronic
1082980297 11:59114703-59114725 CTGGTACGTCACAGGTACCAAGG + Intronic
1085130014 11:74030162-74030184 CTAGTAAGTGACAGAGAGCTGGG - Intronic
1088628177 11:111748234-111748256 CTGCTAGGTAAAAGAGAACAGGG + Intronic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1089083038 11:115793478-115793500 TTGGTGAGTCCCAGAGAGCAAGG - Intergenic
1091920369 12:4299459-4299481 CTGGGAAGTGGCAGAGAAAAGGG - Intronic
1092040570 12:5380269-5380291 CTGATTAGTCACAGTGAAAAGGG + Intergenic
1094265984 12:28560341-28560363 GGGGTAAGTCACCGAGAACTGGG + Intronic
1095798057 12:46242091-46242113 CTAGTAAGAAACAGAGAAGAAGG + Intronic
1096427835 12:51519155-51519177 CTGGTAAGTGGCAGAGCCCAGGG + Intergenic
1097492908 12:60293139-60293161 CATGAAAGTCACAAAGAACAAGG - Intergenic
1097903570 12:64897490-64897512 CTGGTAAGTATCAGAGAATTGGG + Intergenic
1098430053 12:70409157-70409179 ATAGTAGGTCACAGAGTACACGG + Intronic
1098670793 12:73228255-73228277 CTAGAAAGTCAGAGAGAAGATGG - Intergenic
1099941640 12:89196118-89196140 CTGGTAATACACAAAGAACTTGG + Intergenic
1101409168 12:104455221-104455243 CCTGTGAGTCACAGAGATCATGG - Intergenic
1103003414 12:117403378-117403400 CTGATAAATTACAGAGAACTTGG + Intronic
1104550570 12:129753045-129753067 CTTGAAAGTCACATATAACAAGG - Intronic
1107172361 13:37358022-37358044 TTGGAAAATCACAGAGAACAGGG - Intergenic
1107592862 13:41926629-41926651 CTTGGAAATCACAGAGAAGATGG + Intronic
1109469805 13:62790402-62790424 CAGCTATGTCACAGTGAACAGGG - Intergenic
1111000718 13:82176718-82176740 CTGGCAAGATACAGAGAAAAGGG + Intergenic
1111075187 13:83226092-83226114 ATGGTAAGTTACAGGGAAAAAGG - Intergenic
1111830838 13:93327079-93327101 TTGCTAAGTTGCAGAGAACAGGG + Intronic
1113232902 13:108235710-108235732 CTGGTAAGTTACAAAGAATGGGG - Intergenic
1113334105 13:109361680-109361702 CTGTTAAGTAACACAGAAAAAGG - Intergenic
1114351739 14:21860390-21860412 CAGTCAAGTCACAGATAACAAGG + Intergenic
1114415259 14:22538595-22538617 CTGGAAAGGAAAAGAGAACAAGG + Intergenic
1115734149 14:36305834-36305856 GTGGAAAGAGACAGAGAACAAGG - Intronic
1117308329 14:54497942-54497964 CAGGTATGGCACAGAGAGCAGGG - Intergenic
1117447775 14:55821102-55821124 CTGGGAATTCACAGGGAACGGGG + Intergenic
1118409412 14:65462299-65462321 ATGGTAAGTCAGAGAGATCAGGG - Intronic
1120115369 14:80610653-80610675 TTGGTAAGTCAAAGAGTACACGG - Intronic
1121737014 14:96225743-96225765 CTGGTAGGTCACAGAGAAAAAGG - Intronic
1122336902 14:100996914-100996936 CTGGTAAGTCTCTGGGAAAAAGG + Intergenic
1122564887 14:102646284-102646306 CTGTTAAGTCACAGTTAAGAAGG - Intronic
1122798435 14:104217949-104217971 CTGGCAGATCACAGAGAACTTGG - Intergenic
1125193183 15:37017241-37017263 CCAGAAAGTCAAAGAGAACATGG + Intronic
1126098221 15:45104201-45104223 CTTGTCAGCCAGAGAGAACATGG + Exonic
1126106004 15:45147575-45147597 CTTGTCAGCCAGAGAGAACATGG - Exonic
1126612930 15:50547831-50547853 CTGGTAAGTCAAAAAAAGCAAGG + Intergenic
1127613490 15:60659711-60659733 CTGATAAATCACAGACAACAAGG + Intronic
1128536243 15:68492812-68492834 CTGGTAAGTTGCAGAGAGTAGGG + Intergenic
1133489602 16:6254844-6254866 CATGTAAATCCCAGAGAACAGGG - Intronic
1135840773 16:25874080-25874102 CTGGTAAAGCAGAGAGGACAGGG - Intronic
1137257798 16:46791289-46791311 CTGGAAAGTCACAGAAAATAAGG + Intergenic
1138120079 16:54393742-54393764 CTGGGAAGTCATTGGGAACAGGG - Intergenic
1139677660 16:68536150-68536172 CTGGTACCTCCCAGAGAAAAGGG - Intronic
1141272259 16:82552069-82552091 CTTCTATGTCACAGAGATCATGG - Intergenic
1143865606 17:9920922-9920944 TAGGAAAGTCAAAGAGAACAGGG + Intronic
1143948893 17:10617483-10617505 CTGGGATCTCACAGAGAAAAAGG + Intergenic
1146030705 17:29363810-29363832 CTGGGAAGTCCCAGATCACAGGG + Intergenic
1146248072 17:31308740-31308762 GTAGTCAGTCACAGAGAACTTGG - Intronic
1147716579 17:42512723-42512745 TTGGGAAATCACTGAGAACATGG - Intronic
1148407184 17:47425629-47425651 CTGGGAAGTCACAGAAGATAAGG + Intronic
1148595868 17:48854995-48855017 CTGGTAGGTGACAGAGATAAGGG + Intronic
1148616611 17:49005211-49005233 CAGGTAAGTCACAGAAAAGTAGG + Intronic
1149279467 17:55086544-55086566 CTGGAAGGACACGGAGAACAGGG - Intronic
1151474407 17:74337666-74337688 CTGGAAAGTGCCAGAGCACAGGG - Intronic
1151758925 17:76089866-76089888 CTGGTAAGTCCCAGAGAGGAGGG + Intronic
1152345967 17:79752044-79752066 GTGGTAAGACACACATAACAGGG - Intergenic
1153203557 18:2671477-2671499 CTGTAAAGTCACAGAAATCAAGG - Intronic
1155244422 18:23893730-23893752 CTGTTAAGTCACAGAGCAGCAGG + Intronic
1156513070 18:37657745-37657767 CTGAAAACTCACAGAGAACAGGG - Intergenic
1156839564 18:41595162-41595184 AGGGTAAGTCAGAGGGAACAGGG + Intergenic
1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG + Intergenic
1158725850 18:59970869-59970891 CTGGGAAGTCACAGAAGATAAGG + Intergenic
1162532800 19:11245590-11245612 GGGGTAGGTCACAGAGAAGATGG + Exonic
1164189659 19:22902282-22902304 GTGTTAAGAGACAGAGAACAAGG - Intergenic
1164650151 19:29885633-29885655 CAGGTAGGTCACAGAGATGAAGG - Intergenic
1164903136 19:31945388-31945410 TTGGGAAGCCACAGAGAGCAAGG - Intergenic
1167724288 19:51200190-51200212 CTAGGAAGTCACAGTGACCATGG - Intergenic
925312851 2:2899039-2899061 CAGGTGTGTCACAGAGAACAAGG - Intergenic
926384864 2:12326054-12326076 CTGGTGAGTCACTGAGTTCATGG + Intergenic
927386675 2:22542405-22542427 CTGATATTTCACAGAGACCAAGG - Intergenic
927822549 2:26280979-26281001 CTGGGAAGTCGCAGAAGACAAGG + Intronic
928658599 2:33478347-33478369 CAGGGAAGTCACAGACCACATGG - Intronic
929210358 2:39350060-39350082 CTGGTAACTAACAGAGGACAGGG + Intronic
929487623 2:42369088-42369110 GTGATAGGCCACAGAGAACATGG - Intronic
930709715 2:54539066-54539088 CTAATAAGACACAGAGAACATGG - Intronic
930880181 2:56261625-56261647 ATGGTAAGTCCCTGAGGACAGGG - Intronic
935397343 2:102621846-102621868 CTGGTCAGTTAGAGAGAAAAGGG + Intronic
937588820 2:123589921-123589943 ATGTTAAGTCACATAGAAAATGG + Intergenic
937858733 2:126691638-126691660 CAGGGAAGTCCCAGAAAACAGGG - Intronic
937859239 2:126695225-126695247 CAGGAAAGTCCCAGAAAACAGGG - Intronic
939116508 2:138067726-138067748 TTGGAGAGCCACAGAGAACAAGG - Intergenic
940324205 2:152408048-152408070 CTGGAAGGTGGCAGAGAACAGGG + Intronic
943512089 2:188838882-188838904 ATGGTAACTGAAAGAGAACAGGG + Intergenic
944910988 2:204310346-204310368 CTGGTACTTAACAGAGAGCAAGG - Intergenic
945309035 2:208288982-208289004 CTGGAAAGTCACTGAGAGAATGG - Intronic
945391670 2:209272853-209272875 CTGGTAAGTCAGAGATGAAAGGG - Intergenic
946583443 2:221156873-221156895 CTGCTAAGGCATGGAGAACAGGG + Intergenic
946928660 2:224650869-224650891 TTGGTATGTCACAGGGAACTTGG + Intergenic
948228424 2:236331608-236331630 CAGAAAAGACACAGAGAACAAGG + Intronic
948424581 2:237878913-237878935 CTGATAAGACACAGTGAACCAGG + Intronic
1168972807 20:1942341-1942363 CTGGTCAGGCACAGTGAAGAGGG - Intergenic
1169009549 20:2238748-2238770 CTGGAAAGTAACAGGGAACTGGG + Intergenic
1169014922 20:2283755-2283777 CTGGTAAGTTAAAGAAAAAAGGG + Intergenic
1169681606 20:8220531-8220553 ATGGGGAGTCACAGAGAAGAAGG + Intronic
1169940004 20:10926675-10926697 CTGGGGAGTCACAAAGCACAGGG - Intergenic
1171415716 20:24979295-24979317 CTCGTATTTCACAGAGAAGATGG + Intronic
1173227750 20:41171897-41171919 CTGGAAGGTCACTGGGAACATGG + Intronic
1174300385 20:49577955-49577977 CTAGTAAGCCACAAAGAACATGG + Intergenic
1175364280 20:58441099-58441121 CTGGTAATCTACAGAAAACAAGG + Intronic
1177561044 21:22754136-22754158 CTGGACTGTCACAGAAAACATGG + Intergenic
1181533888 22:23532016-23532038 CTGGAAATGCACAGAGAGCAGGG + Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1183806187 22:40213259-40213281 ATGGAAAGTCAAAGAGCACATGG + Intronic
952205211 3:31174515-31174537 CTGGGAATTCATTGAGAACAAGG - Intergenic
953000182 3:38925038-38925060 ATGGGAAGTCACAGGGTACAGGG - Intronic
953069308 3:39503414-39503436 CTGGTAAATCTCAAACAACACGG - Intronic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955222436 3:57034332-57034354 ATGGTGAGTCAAAGAGAAGACGG + Intronic
956913532 3:73846533-73846555 CTTGTAAGTCACACAGTTCATGG - Intergenic
957036410 3:75297377-75297399 CTGCTCAGTCACAGATAACCAGG + Intergenic
959263250 3:104106498-104106520 TTGGTAAGGCACAGAGAAAAAGG + Intergenic
959555603 3:107713794-107713816 CTGGTATGTAAAAGAGAACAGGG - Intronic
959574467 3:107919444-107919466 CCTGAAAGTCACAGAGAACAGGG - Intergenic
961009857 3:123428500-123428522 CTGGTGATTCTCAGAGGACAGGG - Intronic
963933751 3:151031557-151031579 GTGGTAAGTCAGAAAGAAGAAGG + Intergenic
965426688 3:168533225-168533247 ATAGTAAATCACTGAGAACAAGG - Intergenic
966579875 3:181548877-181548899 CAGGAAAGTTACAGAGTACAAGG - Intergenic
967672938 3:192260759-192260781 ATGGAAAGACACAGAGGACAGGG + Intronic
968661631 4:1801111-1801133 CTGTGAAGTCACAGGGCACAGGG - Intronic
969433294 4:7168632-7168654 CTGGGCAGCCACAGAGAGCAAGG - Intergenic
971161824 4:24141231-24141253 TTGAAGAGTCACAGAGAACAAGG + Intergenic
972193001 4:36617133-36617155 ATGGTAAGTAAAAGAGAGCAGGG + Intergenic
972340835 4:38151250-38151272 CTGGTACCTCCCTGAGAACAGGG + Intergenic
974617133 4:64304758-64304780 CTGATAAGTCACAGAAAAATTGG + Intronic
977225814 4:94390318-94390340 CTGTTGTGTCTCAGAGAACAGGG + Intergenic
980036660 4:127892020-127892042 TTGGAATGTTACAGAGAACATGG + Intronic
980546591 4:134271336-134271358 TTGTTATGTCTCAGAGAACAGGG - Intergenic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
983467819 4:168116848-168116870 CTGTTAGGTCACAAAGAACATGG - Intronic
987015743 5:13817142-13817164 CTATAAAGTCACAGAGAAAATGG - Intronic
988629417 5:32913044-32913066 ATGGTAAGTAACAGACAACATGG + Intergenic
990777238 5:59315838-59315860 CTGGCAAGTCACTGAGCACGCGG + Intronic
992863483 5:80935381-80935403 CTGGTAAGTAACTGAGCAAATGG - Intergenic
996060938 5:119032556-119032578 CTAGTAAATCACAGATAATAAGG - Intergenic
999510935 5:152251098-152251120 AAGGTAAGTCACAGAGATCATGG - Intergenic
1001254559 5:170173435-170173457 CTGGTGAGTCACTGAGATCTCGG + Intergenic
1001835460 5:174827542-174827564 GTGCTAAGGCACACAGAACATGG - Intergenic
1002013038 5:176299458-176299480 CTGGTAATCCAAAGAGAGCAAGG + Intronic
1002466186 5:179410048-179410070 CTGGAAAGTCACAGAGATGGTGG + Intergenic
1003510971 6:6780052-6780074 GAGGGAAGACACAGAGAACAAGG + Intergenic
1006451585 6:34108731-34108753 CTGGGAGGTGGCAGAGAACAGGG + Intronic
1008732401 6:54498480-54498502 ATGGTAAGTAAAAGAGAGCAGGG + Intergenic
1009044011 6:58216071-58216093 CTAGTAAGTGACAGAGAATTTGG - Intergenic
1009219840 6:60970344-60970366 CTAGTAAGTGACAGAGAATTTGG - Intergenic
1009813342 6:68698657-68698679 CTGGTAATTTAAAGAGAACATGG + Intronic
1010366329 6:75055940-75055962 CTGGGAAGTGACAGAAAGCAGGG + Intergenic
1010371707 6:75117362-75117384 CAAGTAAGTCACAGTCAACATGG - Exonic
1011229253 6:85141552-85141574 TTGTTAAGTCAAAGAGTACAGGG - Intergenic
1013080688 6:106809279-106809301 CAGCTATGTCACAGTGAACAGGG + Intergenic
1014664720 6:124222791-124222813 CTGCTAAGTCATGTAGAACATGG + Intronic
1015036273 6:128658707-128658729 CTGGGAAGGAAAAGAGAACAAGG + Intergenic
1015406429 6:132841918-132841940 TGGGTAAATCACAAAGAACAAGG + Intergenic
1017671058 6:156770144-156770166 CAGGTAAGTGAATGAGAACAAGG + Intergenic
1018083381 6:160277980-160278002 CTGGTAATTCACAGAAAGGAAGG - Intergenic
1018606314 6:165601444-165601466 CTGCTAAGTCACATAAAACACGG - Intronic
1020355290 7:7269231-7269253 ATGGTGAGTCTCAGAGAACTGGG + Intergenic
1021996699 7:26185248-26185270 CTGGGAAGTCACAGAAGATAAGG + Exonic
1022035424 7:26529535-26529557 CTGGAAAGTCACAGAAATCATGG - Intergenic
1024885777 7:54140519-54140541 TTGGCAACTTACAGAGAACATGG - Intergenic
1026023043 7:66725716-66725738 CTGGTATGACAGAGAGGACATGG + Intronic
1027351056 7:77311807-77311829 GTGGTAAGACCCTGAGAACAGGG + Intronic
1027555658 7:79661801-79661823 CTGCTAAGTGGCAGAGATCATGG - Intergenic
1027825226 7:83105576-83105598 CTGGAAAGTTACAGTGAACTTGG + Intronic
1028281275 7:88932137-88932159 GTGGAAAGTCACAGACAAAATGG + Intronic
1028400657 7:90421959-90421981 CTGTGCAGTCACAGAGAACCGGG + Intronic
1028423676 7:90662285-90662307 GTGGGAAGTCACAGAGCCCATGG + Intronic
1030244211 7:107363159-107363181 CTGGAAAGTCAGAGAGACAATGG + Intronic
1031951442 7:127896653-127896675 GTTATAAGTAACAGAGAACAAGG + Intronic
1032148127 7:129402472-129402494 CTGGAAAGTCCCACAGAACTGGG - Intronic
1032621625 7:133539679-133539701 CTGCTAAGTCACACAAAAAAAGG - Intronic
1034558247 7:151863248-151863270 CTGGTAAGTCCCCGGGTACAGGG + Intronic
1035311852 7:157974655-157974677 GTGGTAAGACACAGAGGGCAGGG + Intronic
1035382886 7:158451189-158451211 CTGACAAATCACTGAGAACAAGG - Intronic
1035490064 7:159267913-159267935 CTGGTAATTCATAAAGAAAAAGG + Intergenic
1037713781 8:21378649-21378671 CTGGCAAGGTACAGAGAAAAGGG - Intergenic
1039953099 8:42187566-42187588 CTGGTATCTGACAGAGAGCAGGG + Exonic
1040670605 8:49685574-49685596 CTGGGAACTGACAGAAAACATGG + Intergenic
1041308966 8:56494757-56494779 CTGGTAAGTCAAGGAGAAAAAGG - Intergenic
1043002982 8:74782204-74782226 TTGATAAAACACAGAGAACAGGG - Intronic
1044092354 8:88017578-88017600 CTAGAAAGTCACTGATAACAAGG + Intergenic
1046753411 8:117948378-117948400 ATCTTAAGTGACAGAGAACAAGG + Intronic
1047009891 8:120660855-120660877 TTGTTATGTCACAGGGAACACGG + Intronic
1047858219 8:128935963-128935985 CAGGGAAGTCACAGAGTTCATGG + Intergenic
1048334156 8:133490663-133490685 CTGGTATGTTACAGAAAACAGGG + Intronic
1049505599 8:142994930-142994952 CTGGTAAGGCACAGACAGAAAGG - Intergenic
1050754877 9:8990383-8990405 CATGTAATTCACAGAGAGCAGGG + Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052730423 9:32278749-32278771 CTAGGAACTCACACAGAACAGGG + Intergenic
1054934168 9:70669070-70669092 CGAGAAAGTCACAGAGCACAAGG + Intronic
1055381301 9:75709869-75709891 CTTGTAACTCACAGAGCACTAGG - Intergenic
1055490907 9:76804591-76804613 CTGTGCTGTCACAGAGAACAGGG - Intronic
1055574895 9:77650883-77650905 CTGGTAAGAAACAGAAAACTGGG + Intergenic
1055610899 9:78022962-78022984 CTTGCAAGTCACTGAGAAGAGGG + Intronic
1057517554 9:95734955-95734977 CTGGGCAGCCACAGAGAACAGGG - Intergenic
1058011325 9:99980703-99980725 CTGTGAAGTCACTGAGGACAAGG - Exonic
1058101539 9:100922774-100922796 CTGGCAAGGTACAGAGAAAAGGG - Intergenic
1058479183 9:105373441-105373463 CTAGTAGGTCAAAGAGCACATGG + Intronic
1058832375 9:108830902-108830924 CTGGGAAGGCACAGAGAAGATGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060763467 9:126275573-126275595 CTGGTAAGTCACTGTGAGCCAGG - Intergenic
1061246594 9:129403918-129403940 CTGGAAATGCACAGAGAGCAGGG - Intergenic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1185591876 X:1282724-1282746 GTGGTAACTCACAGAGCAGAAGG - Exonic
1186067134 X:5778202-5778224 CTGGAAAGTCACAGAGCATGTGG - Intergenic
1186118231 X:6327782-6327804 CTGGTAGTTTAGAGAGAACAAGG + Intergenic
1186860299 X:13666386-13666408 CAGCTAAGTCACAGTGAGCAAGG + Intronic
1189950849 X:46229105-46229127 CTGGTGAGTCACTGAGGACCTGG + Intergenic
1190532063 X:51388434-51388456 CTGGTAAGTTGCAGAGAAAAAGG + Intergenic
1191940327 X:66472859-66472881 CTATTAAGTCACAGAGAGAAAGG - Intergenic
1194458597 X:94136554-94136576 CTAGTAAGTGACAGAGTAGAAGG + Intergenic
1196903841 X:120412413-120412435 CTGGTAAGGAACTGAGTACAAGG - Intergenic
1197834859 X:130683580-130683602 CTGGGAAATAACAGTGAACAGGG - Intronic
1198673174 X:139103520-139103542 GAGGGAAGTCACAGTGAACAGGG + Intronic
1199364987 X:146970948-146970970 CATGAAGGTCACAGAGAACAGGG - Intergenic
1199382384 X:147184822-147184844 CATGAAGGTCACAGAGAACAGGG + Intergenic