ID: 903068276

View in Genome Browser
Species Human (GRCh38)
Location 1:20713471-20713493
Sequence TGTCAGCCCCAAGGAGGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 189}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903068263_903068276 25 Left 903068263 1:20713423-20713445 CCCCACCTGCCCACAATGGGTCT 0: 1
1: 0
2: 1
3: 24
4: 280
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068272_903068276 -5 Left 903068272 1:20713453-20713475 CCTCCAGCTTCTGCTTGGTGTCA 0: 1
1: 0
2: 5
3: 37
4: 293
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068271_903068276 -2 Left 903068271 1:20713450-20713472 CCACCTCCAGCTTCTGCTTGGTG 0: 1
1: 0
2: 8
3: 61
4: 606
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068267_903068276 16 Left 903068267 1:20713432-20713454 CCCACAATGGGTCTGCACCCACC 0: 1
1: 0
2: 1
3: 15
4: 158
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068270_903068276 -1 Left 903068270 1:20713449-20713471 CCCACCTCCAGCTTCTGCTTGGT 0: 1
1: 0
2: 5
3: 32
4: 341
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068264_903068276 24 Left 903068264 1:20713424-20713446 CCCACCTGCCCACAATGGGTCTG 0: 1
1: 0
2: 0
3: 23
4: 144
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068273_903068276 -8 Left 903068273 1:20713456-20713478 CCAGCTTCTGCTTGGTGTCAGCC 0: 1
1: 0
2: 2
3: 26
4: 271
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068265_903068276 23 Left 903068265 1:20713425-20713447 CCACCTGCCCACAATGGGTCTGC 0: 1
1: 0
2: 0
3: 17
4: 181
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068268_903068276 15 Left 903068268 1:20713433-20713455 CCACAATGGGTCTGCACCCACCT 0: 1
1: 0
2: 2
3: 44
4: 180
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068260_903068276 29 Left 903068260 1:20713419-20713441 CCAGCCCCACCTGCCCACAATGG 0: 1
1: 0
2: 3
3: 51
4: 419
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189
903068266_903068276 20 Left 903068266 1:20713428-20713450 CCTGCCCACAATGGGTCTGCACC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903068276 Original CRISPR TGTCAGCCCCAAGGAGGTCC CGG Exonic
902783363 1:18718104-18718126 TGACACCCCCATGGAGGTTCAGG - Intronic
903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG + Exonic
904313733 1:29646414-29646436 TGTCACCACCAAGCAGGTGCTGG + Intergenic
906688909 1:47779864-47779886 TGACAGCCCCAGGGAGGTCTAGG + Intronic
906749620 1:48247329-48247351 CTCCAGCCCCAAGCAGGTCCTGG + Exonic
907569559 1:55470364-55470386 TGTGGGGCCCAAGGAGATCCTGG - Intergenic
908262142 1:62347481-62347503 TTCCAGCCCCATGGAGGTCTGGG - Intergenic
908510396 1:64846331-64846353 AGTCAGGCCCAAGGAGCTCTGGG - Intronic
911519238 1:98908845-98908867 TGTGAGCCCTAAGGAAGTACAGG + Intronic
911998797 1:104802889-104802911 TGTCAGCCCCATGGTGATCTGGG - Intergenic
915590714 1:156868664-156868686 TGGCAGCCCCCAAGAGGTCCAGG + Intronic
916684591 1:167132865-167132887 TGTCAGCCCCATGGGGCCCCAGG + Intergenic
918258739 1:182774694-182774716 TGTCAGCAGCAAGGGGGTCAGGG - Intergenic
920250279 1:204618474-204618496 TGTCAGCCCCCACCAGGTTCTGG + Exonic
923679718 1:236109835-236109857 TGCCAGCCACACAGAGGTCCTGG + Intergenic
923857640 1:237862324-237862346 TGATAGCCCCTAGCAGGTCCAGG + Intergenic
924500070 1:244629289-244629311 AGTCAGCCAGAATGAGGTCCAGG - Intronic
1070789612 10:79181452-79181474 CCTCCGCCCCAAGGAGGTGCTGG - Intronic
1072687377 10:97546291-97546313 TGTCAGGCCACAGGAGGGCCAGG + Intronic
1072724890 10:97806548-97806570 TGTCAGGCCATAGGAGGTCCTGG + Intergenic
1073061713 10:100737377-100737399 CGTCAGGCCCAAGTAGGTGCAGG - Intronic
1073578170 10:104641878-104641900 GGTCAGCGCGAAGGAGGTGCTGG - Exonic
1077366385 11:2162941-2162963 TGTGAGCCCCCAGGAAGCCCTGG - Intergenic
1077907748 11:6547044-6547066 CCTCAGCCCCCAGGAGTTCCTGG + Exonic
1079159467 11:17978619-17978641 TGGCTGCCCCATGGAGATCCAGG - Intronic
1081253229 11:40861297-40861319 TGTCAGCTCCAAGGAGACCTGGG + Intronic
1083036025 11:59638350-59638372 TGGCAGCCAAAAGGAGGTACAGG + Exonic
1083962627 11:66022778-66022800 GATCAGGCCCACGGAGGTCCTGG + Intronic
1084378172 11:68792574-68792596 TGTCATTCTCAAGGACGTCCTGG + Intronic
1084499182 11:69524923-69524945 TGGAAGCCCCAAGGAGCTCACGG + Intergenic
1084601739 11:70149847-70149869 TGTAAGTCCCAAGGAGGTCCTGG - Intronic
1085253031 11:75155953-75155975 GCTCAGTCCCAAGGAGGTCAAGG - Intronic
1085347370 11:75776874-75776896 TTCCAGCCCCAGGGAGGTCTAGG - Intronic
1085350659 11:75796212-75796234 CCTCAGGCCCATGGAGGTCCAGG + Intronic
1085526576 11:77167514-77167536 TTTCAGACCTAAGGAGGTCCGGG - Intronic
1086139039 11:83474031-83474053 TCTCAGTCCCAAGGAGGGCCTGG + Intronic
1091965307 12:4735723-4735745 TGGCAGCCCCCTGGAGCTCCTGG - Intronic
1094275354 12:28668905-28668927 GCTCAGGCCCAGGGAGGTCCAGG - Intergenic
1094423621 12:30297236-30297258 TGTCAGCCCCAAGAAGATGTAGG + Intergenic
1096072297 12:48782200-48782222 TTTCAGCCCCACGGTGGCCCTGG + Intronic
1096106471 12:48999233-48999255 TGACAGCCCCCGGGAGCTCCAGG - Exonic
1096145839 12:49277937-49277959 TGTCAGCCCCAAGCAGGTTTTGG + Intergenic
1097202946 12:57295139-57295161 TGGCAGACCCAAGGAGTTCCAGG + Intronic
1097305624 12:58066149-58066171 TGTCACCCAGAAAGAGGTCCAGG + Intergenic
1097909457 12:64953840-64953862 TGGTTGACCCAAGGAGGTCCTGG - Intergenic
1097961633 12:65537138-65537160 AGTCAACTCCATGGAGGTCCTGG - Intergenic
1099199147 12:79655279-79655301 TGACAGCCCCAATTAGCTCCAGG + Intronic
1102534447 12:113570124-113570146 TGCCAGGCCCAAGGATGCCCCGG + Intergenic
1103209217 12:119154463-119154485 TCCCAGCCCCAAGGAGGCCTAGG - Intronic
1103360109 12:120348340-120348362 TCTCAGCCCCAGGGAGCCCCAGG - Intronic
1103406657 12:120680619-120680641 TGTCAGTCCCCAGGTGGCCCTGG - Intergenic
1103605149 12:122080419-122080441 TGTGAGCCCCAAGCATATCCAGG + Intronic
1110358978 13:74603870-74603892 TGTAAGGCTCAAGGAGGTGCTGG - Intergenic
1112865098 13:103885448-103885470 TTTCACCCTCAAGTAGGTCCTGG - Intergenic
1113848023 13:113403542-113403564 TCTCAGCCCCAGGGTGGTCTGGG + Intergenic
1114612612 14:24052448-24052470 AGTCAGCCCCAGGGAGCGCCAGG - Intronic
1118702406 14:68446636-68446658 AGACAGCCACAAGGAGCTCCAGG - Intronic
1119207146 14:72802935-72802957 CATCACCCCCATGGAGGTCCAGG + Intronic
1121329572 14:93041435-93041457 GGTCAGCCCCAGGAAGGTTCTGG - Intronic
1122598669 14:102909976-102909998 TGTCAGCCCAAGGGAGGGCCGGG + Exonic
1122822669 14:104355061-104355083 TTGCTGCCCCAGGGAGGTCCTGG + Intergenic
1123034127 14:105464974-105464996 TGTCAGCACCGAGGAGGACGTGG - Intronic
1123059292 14:105587215-105587237 CTTCAGCCCCAAGGATGTGCTGG - Intergenic
1123083624 14:105707446-105707468 CTTCAGCCCCAAGGATGTGCTGG - Intergenic
1125957397 15:43799936-43799958 TGCCAGGCCCAGGGAGGTGCCGG + Exonic
1126070731 15:44862870-44862892 TCTCAGCAGCAAGGAGGTCTAGG + Intergenic
1126308831 15:47292611-47292633 TGGCAGGGCCAAGGAGGTCTTGG + Intronic
1128318481 15:66676392-66676414 TCTCTGCCCCAAGGAGCTCCTGG + Intronic
1128520380 15:68370927-68370949 TGACAGCGCCAAGGTGGACCGGG - Intronic
1128521012 15:68374931-68374953 TGCCAGCCCCAAAGCTGTCCTGG - Intronic
1128656265 15:69464179-69464201 CTTGAGCCCCAAGGAGGTCGAGG - Intergenic
1131411818 15:92213840-92213862 TCTCAGCAGCAAGGAGGTCTAGG - Intergenic
1132582700 16:692812-692834 TGCCAGCCCCAGGAAGCTCCAGG - Exonic
1132722000 16:1321054-1321076 TGTCTGCACCGAGGAGGGCCTGG + Intronic
1134254348 16:12599377-12599399 TGGCAGCCTTAAAGAGGTCCAGG + Intergenic
1136125047 16:28173178-28173200 TGTGATATCCAAGGAGGTCCTGG + Intronic
1138598327 16:58041211-58041233 TGCCAGCCCCGAGGAGGGCTCGG - Intronic
1141818868 16:86431594-86431616 AGCCAGCCCCAAGGAAGGCCAGG + Intergenic
1141826136 16:86481662-86481684 TGTCAGCCCCAAGGTTGCCATGG + Intergenic
1144392238 17:14804516-14804538 TGTCAGCCCAAATGAGAACCAGG + Intergenic
1145124234 17:20286951-20286973 TGCTAGCCCCAAGAAAGTCCTGG + Intronic
1150287564 17:63962624-63962646 TGGCAGCCCCATGGAGACCCTGG + Intronic
1150337883 17:64343486-64343508 TGTCACCCCATAGGAGGTCGGGG - Intronic
1150558443 17:66274738-66274760 TGTCAGAGCCCAGGAAGTCCAGG - Intergenic
1151653792 17:75486087-75486109 TGTCACCCCCAAGCTGCTCCTGG + Intronic
1151679866 17:75617489-75617511 TGACAGCCCCAAAGATGCCCAGG - Intergenic
1152337797 17:79707991-79708013 GGTCAGCCCCCAGGTGCTCCTGG + Intergenic
1152778503 17:82216270-82216292 TGTCAGCCCCACACAGGTCCAGG - Intergenic
1152844654 17:82592345-82592367 TGTGAGCCCCATGAAGGACCAGG - Intronic
1153713177 18:7820266-7820288 TGTGAGCTGCAAGGAGGGCCTGG + Intronic
1157323203 18:46649688-46649710 TGTCAGTGCCCAGGAGGTCATGG - Intronic
1159894711 18:73985422-73985444 TGTCAGCCCCCAGAAGGACAAGG - Intergenic
1160225560 18:77008596-77008618 TGAGAGCCCCAAGGTGGTCGTGG - Intronic
1160997150 19:1888068-1888090 TGACAGCCCCAGGGAGACCCAGG - Intergenic
1161084934 19:2330614-2330636 TGTCACCACCAAGGAGGCCCGGG + Intronic
1162557190 19:11394565-11394587 TGTCACCCCCACAGAGGACCCGG + Intronic
1165092823 19:33395692-33395714 TGACAGCCCCAGGGGGCTCCCGG + Intronic
1165968789 19:39607515-39607537 TGTCATCCCCAAGGGGGGCCAGG + Intergenic
1165979674 19:39709488-39709510 GGTCATCCCCAAGAGGGTCCAGG + Intergenic
1166392035 19:42413773-42413795 TGTCATCCCCCAGGTGGCCCTGG + Intronic
1166549810 19:43657691-43657713 TGTGAGCCCCCAGGAGGGCAGGG + Intronic
1166966801 19:46533897-46533919 TGCCATCCCCACAGAGGTCCTGG + Intronic
925188575 2:1865630-1865652 TGCCAGCCTCCAGGAGATCCGGG - Intronic
925390668 2:3491855-3491877 TGCAAGCCCCAGGGAGGCCCCGG + Intergenic
925571168 2:5314182-5314204 TGACAGCCCCAAGGAGTTGCTGG + Intergenic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
929155460 2:38784837-38784859 TGACAGCCCAAAGGAGGCACTGG - Exonic
933777736 2:85781064-85781086 TGTCAAACGCAAGGATGTCCAGG + Intronic
934556057 2:95287545-95287567 GGTCACCCCCAAGGGGCTCCGGG - Intronic
934574253 2:95390537-95390559 TGCCAGCCCAAAGTAGGTACTGG + Intergenic
937996436 2:127698077-127698099 TGTCAGCACCAGGCAGGGCCTGG - Intergenic
938248458 2:129796449-129796471 GGTCACCCCCAAGAAGGCCCTGG - Intergenic
939001801 2:136745364-136745386 AATCACGCCCAAGGAGGTCCAGG + Intergenic
945219957 2:207473466-207473488 TGGCAGCCCCCAGGAGCTCAGGG - Intergenic
947526077 2:230877459-230877481 TGTCAGTGACAAGGAGGCCCTGG + Exonic
948343069 2:237270618-237270640 TGTCAGCAACTAGCAGGTCCCGG - Intergenic
948641790 2:239379687-239379709 TGGCAGCCCCAAGGAGCCCCAGG + Intronic
948946602 2:241223688-241223710 TGTCAGGCACCAGGAGGTCCAGG - Exonic
1170424278 20:16223140-16223162 TCTCAACCCCAAGGAGCACCAGG - Intergenic
1170568478 20:17619919-17619941 TGTCAGTCCCCAGGAGTGCCCGG - Intronic
1170592894 20:17784619-17784641 TGTCAGCTCCTAGGACGGCCTGG - Intergenic
1170818932 20:19739620-19739642 CATCAGCTCCAAGGAGGACCGGG + Intergenic
1171134881 20:22687095-22687117 TGGCAGCCACATGGAGCTCCAGG - Intergenic
1172520056 20:35560428-35560450 TCTCAGCACCACGGAGGGCCTGG + Intergenic
1173010955 20:39181549-39181571 TGTCAGCTTCTAGGAGGTCCTGG - Intergenic
1175418734 20:58817936-58817958 TCTCAGCTCCAAGGAGGCCTTGG + Intergenic
1175539713 20:59740918-59740940 TGGCTGCCCCAAGGAGGCCCAGG - Intronic
1176732797 21:10517663-10517685 TGGCAGCCACAAGGAGTTCTAGG - Intergenic
1180950313 22:19717952-19717974 GGTCAGCCCCAAGCAGGGCTGGG + Intronic
1182077183 22:27502861-27502883 TGTCAGCCCAAAGCAGGCACTGG + Intergenic
1185241465 22:49749691-49749713 GGTCAGCCTCCAGGAGCTCCCGG + Intergenic
950260075 3:11537106-11537128 TGTCAGCCCCCCGGAGCCCCTGG + Intronic
951300852 3:20994727-20994749 TGTCAACCAAAGGGAGGTCCGGG + Intergenic
952887783 3:38022116-38022138 TGTCACCCCTGAGGAGGCCCAGG - Intronic
953171980 3:40515162-40515184 TGTAAGTCCCAAAGAGGGCCTGG - Intronic
954362284 3:50128435-50128457 GGTCAGCCTAAAGGAGGCCCAGG + Intergenic
955456106 3:59123283-59123305 GGTCAGCCCCAAGGTGGCCATGG - Intergenic
956289532 3:67647054-67647076 TGAGAGCCCTAAGGAGGTTCAGG - Intronic
959594592 3:108115288-108115310 TGTCAGCCCCAAGGAAACCTGGG - Intergenic
960994744 3:123333430-123333452 TCTCAGGCCCAGGGAGCTCCAGG - Intronic
961824108 3:129589843-129589865 GGGCAGCCCCAAGGGGGTGCGGG - Intronic
962290782 3:134134704-134134726 TGTCAGCTCCAGGGAGGGCTGGG + Intronic
963481668 3:145882670-145882692 TGGCAGCCCCACTGAGCTCCAGG - Intergenic
967989551 3:195120950-195120972 TGTGAGCCCCAGGGAGGTAGGGG - Intronic
969272809 4:6114328-6114350 GGGCAGCCCCAAAGAGGTCAAGG + Intronic
969444934 4:7239330-7239352 TGGCAGTCCAAAGGAGGTCGGGG - Intronic
970231733 4:13917779-13917801 TGTCAACCCCAGGTAGGGCCTGG + Intergenic
976280728 4:83324612-83324634 TGACAGCCCCAAAGAGCTCTAGG + Intronic
978782138 4:112567218-112567240 GGTCAGCTCCAAGGAGCTCAGGG - Intronic
983929281 4:173435365-173435387 CCTCAGAACCAAGGAGGTCCTGG + Intergenic
988934387 5:36067555-36067577 TGTCAGCCCCAGTGAGGTCAGGG + Intronic
989732762 5:44667849-44667871 TGGTAGCACCAAGGAGGTCTGGG + Intergenic
992218724 5:74550578-74550600 TGTCAGCAGGAAGGAAGTCCTGG - Intergenic
995012778 5:107276449-107276471 TGACAGCAGCAAGGAGGTTCTGG + Intergenic
995585271 5:113642326-113642348 TCACAGTCCCAAGGAGGCCCTGG - Intergenic
995594184 5:113730885-113730907 GGTCAGGCCCAGGGAGATCCGGG + Intergenic
999661683 5:153871040-153871062 TGTCAGCCCAAAGAAGCTCAGGG + Intergenic
1000122216 5:158208160-158208182 TATGGGCCCCAGGGAGGTCCAGG + Intergenic
1000946176 5:167426088-167426110 TGTCAGATCCAAGGGAGTCCGGG - Intronic
1001055464 5:168445754-168445776 TGTCAGCCCCATGGTGTTACTGG + Intronic
1001230435 5:169982595-169982617 TGGCAGGCCCCAGGAGGTGCTGG + Intronic
1002179930 5:177426187-177426209 TGCCAGCCCGCAGGAGGCCCAGG + Intronic
1002201272 5:177529947-177529969 TTTCAGCCCCAAGGACAACCAGG - Intronic
1003395549 6:5749494-5749516 TGCCAGTCCCAAGGAGGAGCTGG - Intronic
1003486804 6:6587138-6587160 TGGTAGCCCCTAGAAGGTCCAGG - Intergenic
1004871489 6:19908986-19909008 TGTCAGCCCAGATCAGGTCCTGG - Intergenic
1005847605 6:29793337-29793359 TGGCAGCCCCTGGGAGGTGCAGG - Intergenic
1006459699 6:34151200-34151222 TGTCAGCCCAGTGGAGGGCCAGG - Intronic
1007372423 6:41434903-41434925 TGGCATCCTGAAGGAGGTCCTGG - Intergenic
1007383666 6:41505839-41505861 GATCAGCCCCAAGGGGGACCCGG - Intergenic
1007934969 6:45724957-45724979 TGTCAGCTCCAAGGAGGAGAGGG - Intergenic
1011724981 6:90201803-90201825 AGTCTGCCACAAGGAGGACCTGG + Intronic
1016296207 6:142575808-142575830 TGTTATCCCCAAGGAGTCCCAGG - Intergenic
1017029831 6:150211227-150211249 TGTCAGCCACAGTGAGGCCCTGG - Intronic
1018093175 6:160362949-160362971 TGTCGGCCCAAAGGAGACCCTGG - Intronic
1021572768 7:22082803-22082825 TGCCAGCTCCAAGTAGGTCGAGG + Intergenic
1023830905 7:44038639-44038661 TGTCAGAACCTAGGAGGGCCGGG - Intergenic
1027261934 7:76471007-76471029 TGCCCGGCTCAAGGAGGTCCTGG - Intronic
1027313316 7:76969106-76969128 TGCCCGGCTCAAGGAGGTCCTGG - Intergenic
1028281713 7:88937958-88937980 TGACAGCCCTCAGGAGGTCCTGG + Intronic
1029741241 7:102492959-102492981 TGTCAGAACCTAGGAGGGCCGGG - Intronic
1029759231 7:102592128-102592150 TGTCAGAACCTAGGAGGGCCGGG - Intronic
1029776601 7:102688038-102688060 TGTCAGAACCTAGGAGGGCCGGG - Intergenic
1032079726 7:128852835-128852857 CTTCACCCCCAAGGAGGTCGGGG + Exonic
1032511373 7:132475236-132475258 TGTCAATCCCAAGGAGGGCTGGG - Intronic
1034957621 7:155344637-155344659 GGAGAGCCCCAGGGAGGTCCCGG - Intergenic
1034960624 7:155362198-155362220 CCTCAGCCCCAAGGAGCTGCAGG + Intronic
1040692961 8:49962037-49962059 TCTGAGCCCCAGGGAGGCCCTGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046705727 8:117449443-117449465 TCTCAGCCCCAAAGACGACCAGG + Intergenic
1047423273 8:124724805-124724827 TGACTGCATCAAGGAGGTCCTGG - Intronic
1049718346 8:144104177-144104199 TGGCAGCCCATTGGAGGTCCCGG - Exonic
1049751373 8:144285872-144285894 TGTCATCCCGAAGGCAGTCCAGG - Intronic
1051211503 9:14749611-14749633 TGGCAGCGCCAAACAGGTCCTGG - Intronic
1053140218 9:35677777-35677799 TGTCATCCCCCAGGAGGGCCCGG + Exonic
1058393826 9:104526396-104526418 TGTCTTTCCCAAGGAGGTCCTGG + Exonic
1058924062 9:109644238-109644260 TGTGAGACCCAAGGAGGGACAGG - Intronic
1059288541 9:113199891-113199913 CGTCTGCCACAATGAGGTCCTGG + Exonic
1061118156 9:128627562-128627584 TTCCAGCCCCAAGGAGGTGGTGG + Intronic
1061769333 9:132905939-132905961 TGTCAGGCCCAAGCTTGTCCAGG + Exonic
1062287887 9:135781248-135781270 TGTCAGCCCAGAGGAGCTCACGG - Intronic
1062362303 9:136193749-136193771 TGTCAGCGCCTAAAAGGTCCCGG + Intergenic
1185612099 X:1398903-1398925 TGTGAGCCCTACGGAGGCCCTGG + Intergenic
1189776840 X:44477275-44477297 TGACCGGCTCAAGGAGGTCCTGG - Intergenic
1190233915 X:48601723-48601745 GGTCAGACTCAAGGAGGGCCTGG + Intronic
1192412608 X:70947680-70947702 TGACAGCCCTCAGGAGGTACTGG - Intergenic
1192853432 X:74981551-74981573 TGTCACCTCCAAGCAGGTGCTGG + Intergenic
1193768518 X:85561078-85561100 GCTCAGCCCCAGGGAGATCCAGG + Intergenic
1195086547 X:101418696-101418718 TCTCAGCCCCAGGGCAGTCCAGG + Intronic
1197355967 X:125437684-125437706 TAGCAGCCAGAAGGAGGTCCAGG - Intergenic
1198233058 X:134711738-134711760 TGTCAGCAGCAAGAAGGTCTGGG + Intronic
1199634843 X:149805311-149805333 AGTCCGCCCCCAGGTGGTCCAGG - Intergenic