ID: 903070889

View in Genome Browser
Species Human (GRCh38)
Location 1:20726601-20726623
Sequence CAGCAGGACGAGCCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903070885_903070889 -7 Left 903070885 1:20726585-20726607 CCCCACGCTGGTTCAGCAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 337
903070884_903070889 -4 Left 903070884 1:20726582-20726604 CCGCCCCACGCTGGTTCAGCAGC 0: 1
1: 0
2: 0
3: 15
4: 162
Right 903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 337
903070887_903070889 -8 Left 903070887 1:20726586-20726608 CCCACGCTGGTTCAGCAGCAGGA 0: 1
1: 0
2: 1
3: 6
4: 143
Right 903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 337
903070888_903070889 -9 Left 903070888 1:20726587-20726609 CCACGCTGGTTCAGCAGCAGGAC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903070889 Original CRISPR CAGCAGGACGAGCCTGCAGC AGG Intronic
900523917 1:3119317-3119339 CAGAGGGCCAAGCCTGCAGCGGG - Intronic
900631085 1:3635745-3635767 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
901357471 1:8663809-8663831 CAGCAGGAGGAGCATGCAGGAGG - Intronic
901517896 1:9761675-9761697 CAGCAGGGCCAGCCTAAAGCTGG - Intronic
901814350 1:11785337-11785359 CAGCAGGGGGAGCCTGCTGCTGG + Intronic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
903230203 1:21917357-21917379 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
904018529 1:27443088-27443110 CAGGAAGTCGAGCCTGCAGTAGG + Intronic
904620652 1:31773050-31773072 CAGCAGAATGAGCGTGAAGCCGG - Intergenic
906195852 1:43930458-43930480 CAGCAGGCCCAGCATGCAGGTGG + Exonic
906210128 1:44008244-44008266 CAGCGGGCTGAACCTGCAGCAGG + Intronic
906570223 1:46831569-46831591 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
907081614 1:51628755-51628777 CAGCAGGCAGAGGCTGCAGTGGG - Intronic
907255493 1:53175610-53175632 CTGCAGGACAGGCCAGCAGCTGG - Intergenic
907701671 1:56794277-56794299 CAGCAGGAAGAGCATGGAGCAGG - Intronic
908400617 1:63769825-63769847 CAGGAGGAAGAGCTTGCAGTAGG - Intergenic
910053419 1:83003669-83003691 CATGAGGAGGAGACTGCAGCAGG - Intergenic
910155074 1:84207939-84207961 CAGGAGGCAGAGGCTGCAGCGGG - Intronic
913163935 1:116168332-116168354 CAGCGGGCCGAGCCTTCTGCGGG + Intergenic
914831845 1:151176000-151176022 CAGCAGGAGGAGCCCGGTGCCGG + Exonic
914992587 1:152511667-152511689 CAGCAGGAAGAGACTGGAGGTGG - Exonic
915012305 1:152699010-152699032 CAGCAGGAAGAGACTGGAGGTGG - Exonic
915451860 1:156010913-156010935 GTGCTGGAGGAGCCTGCAGCAGG - Intronic
915683492 1:157606219-157606241 CAGCTGAAGAAGCCTGCAGCAGG - Intergenic
916411786 1:164553441-164553463 GAGCAGGAAGAGCCTCCAACAGG - Intergenic
919806360 1:201383077-201383099 GAGCAGAACCAGCCTCCAGCCGG - Exonic
921506537 1:215978051-215978073 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
922024620 1:221739123-221739145 CAGCCGGCGGAGACTGCAGCAGG - Exonic
922412785 1:225392079-225392101 CACCAGGAGGCTCCTGCAGCTGG + Intronic
922533914 1:226365691-226365713 CAGGAGGCAGAGGCTGCAGCAGG + Intronic
923211424 1:231807363-231807385 GAGCAGGACAAGGCTGGAGCTGG - Intronic
923474920 1:234323154-234323176 AAGAAGGAGGAGCCTGCAGAGGG + Exonic
923515300 1:234692736-234692758 CAGCAGGAAGAGGATGCTGCTGG + Intergenic
1062862997 10:824661-824683 CTGCAGGTGGAGCCTGGAGCGGG - Intronic
1063005306 10:1964748-1964770 GAGCAGGACGTGGCTGCTGCTGG + Intergenic
1063087519 10:2833034-2833056 CAGGAGGTCAAGGCTGCAGCGGG - Intergenic
1063152808 10:3352237-3352259 CAGCTGGATGAGCATGAAGCAGG - Intergenic
1063535238 10:6876745-6876767 CAGCAGGGCCAGCCAGCAGCCGG + Intergenic
1063620559 10:7643519-7643541 GAGCAGGACGTGTCTGCAGAGGG - Intronic
1064117380 10:12590289-12590311 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1065913811 10:30334585-30334607 CAGGAGGCAGAGGCTGCAGCGGG + Intronic
1067344473 10:45427734-45427756 CAGCAGGCCTACCCTGCACCTGG + Intronic
1067685218 10:48462792-48462814 TAGCAGGCCAAGCTTGCAGCAGG - Intronic
1068688579 10:59893530-59893552 CAGGAGGCAGAGCCTGCAGTGGG + Intronic
1069242648 10:66162506-66162528 CTGCAGTACCAGCCTGTAGCCGG - Intronic
1069843836 10:71357019-71357041 CAGGAGGTCAAGGCTGCAGCAGG - Intronic
1070490278 10:76969593-76969615 CAGCAGAAAGAGACTGCCGCAGG + Intronic
1072189051 10:93066005-93066027 CAGCAGGACGAGCGAGGTGCTGG - Exonic
1072362284 10:94671285-94671307 CAGGAGGTTGAGGCTGCAGCGGG - Intergenic
1072505559 10:96062805-96062827 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1073048301 10:100652968-100652990 CAGCAGGTCTGGTCTGCAGCAGG - Intergenic
1075154228 10:119960958-119960980 CAGCAGGAAGAAACAGCAGCAGG + Intergenic
1075318902 10:121473627-121473649 CAGAAGGACAAGTCTGCAGTGGG + Intergenic
1075674985 10:124290052-124290074 GAGCAGGAACAGCCTGCCGCTGG + Intergenic
1075719003 10:124574309-124574331 CAGGGGGGCGAGCCTGCTGCTGG - Intronic
1075835444 10:125448854-125448876 CAGCAGGAAGAGCCAGCAAAAGG - Intergenic
1076982729 11:213430-213452 GAGGAGGAGGGGCCTGCAGCTGG + Intronic
1077081188 11:725435-725457 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1077128878 11:959258-959280 CGGCAGGAAGGGGCTGCAGCAGG - Intronic
1077498040 11:2896239-2896261 CAGGGGGAGGAGCCAGCAGCTGG - Intronic
1078742002 11:14075470-14075492 CAGCAGGAGGATCGTGCAGGAGG - Intronic
1083152909 11:60804304-60804326 CAGCAAGCCCAGCGTGCAGCAGG + Intergenic
1083311514 11:61786229-61786251 CAGCAGAGCTGGCCTGCAGCGGG - Exonic
1084461393 11:69298486-69298508 GAGCAGGCCGAGGCTGCAGGTGG + Intronic
1084592781 11:70100090-70100112 CAGCAGGACTAGGCTGCCCCAGG - Intronic
1084666522 11:70579380-70579402 CAGCCAGAAGAGGCTGCAGCTGG + Intronic
1085237344 11:75025322-75025344 CAGCAGGAAGGGCCTGCACTTGG + Intergenic
1085533421 11:77204568-77204590 CAGCCGGCCCAGCCTGCACCAGG - Intronic
1086286448 11:85256638-85256660 CAGGAGGAGGAGCATGCAGATGG - Intronic
1086769516 11:90744832-90744854 CAGCAGGACGAGCTTGGACCTGG - Intergenic
1087050374 11:93880884-93880906 CAGCAGGCAGAGGTTGCAGCGGG - Intergenic
1090247484 11:125226840-125226862 CAGCTGGGCCAGCCTGCAACAGG - Intronic
1091070213 11:132556010-132556032 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1091123910 11:133079829-133079851 CAAAAGGCAGAGCCTGCAGCAGG - Intronic
1091274730 11:134342538-134342560 GGGCAGGCCGAGGCTGCAGCCGG - Intronic
1092880785 12:12886346-12886368 CAGGAGGCTGAGGCTGCAGCGGG - Intergenic
1093282710 12:17215244-17215266 CAGCAGGACTAGACTCCAGAGGG + Intergenic
1094708943 12:32941752-32941774 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1095584320 12:43834017-43834039 CAGCAGGTCAAGGCTGCAGTAGG + Intergenic
1096415630 12:51410061-51410083 CTGCAGGAGGATTCTGCAGCTGG + Intronic
1096442040 12:51651275-51651297 CAGCAGGTGGAGGTTGCAGCAGG - Intronic
1101927840 12:108987993-108988015 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1103048098 12:117755190-117755212 GAGTAGGAAGAGCCTCCAGCGGG + Intronic
1103893252 12:124255531-124255553 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1104083835 12:125457011-125457033 CAGCCAGACCTGCCTGCAGCAGG - Intronic
1104602719 12:130163862-130163884 CAGGAAGACCAGCGTGCAGCCGG - Exonic
1104968973 12:132522663-132522685 CAGCAGGTGGGGCGTGCAGCAGG - Intronic
1107816458 13:44249121-44249143 CAGGAGGTCGAGACTGCAGTGGG + Intergenic
1108294219 13:48996987-48997009 CAGGAGGCAGAGGCTGCAGCGGG + Intronic
1111179714 13:84647801-84647823 CAGTAGGTTGAGCCTGCAGATGG + Intergenic
1111979158 13:94998833-94998855 CAGGAGGCTGAGGCTGCAGCGGG + Intergenic
1112309582 13:98306586-98306608 CAGGAGTTCGAGGCTGCAGCGGG - Intronic
1112621935 13:101062072-101062094 CATCCGGAAGAGCTTGCAGCTGG - Exonic
1114679399 14:24472103-24472125 CAGCAGGATGAACATGCCGCAGG + Intergenic
1117880831 14:60312027-60312049 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1118397169 14:65347628-65347650 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1119438223 14:74611703-74611725 GAGCAGGACGCGCCTGTCGCGGG - Exonic
1119905454 14:78297991-78298013 CTGCAGGACCACCCTGCAGTGGG + Intronic
1121761150 14:96446172-96446194 CAGCAGGACCGGCCCCCAGCAGG - Intronic
1122669452 14:103359172-103359194 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1123509473 15:20982211-20982233 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1123566695 15:21555950-21555972 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1123602956 15:21993243-21993265 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1124160756 15:27267178-27267200 CAGGAGGAGGAGGTTGCAGCGGG - Intronic
1124254454 15:28129587-28129609 CAGAGGGCCAAGCCTGCAGCAGG + Intronic
1124808334 15:32908327-32908349 CAGCAGGATGACCCTGCTGCCGG - Intronic
1127982763 15:64046516-64046538 CAGCCGGGCGCGCCTCCAGCCGG - Intronic
1128094314 15:64942395-64942417 CCCCAGCACCAGCCTGCAGCTGG + Intronic
1128242410 15:66109995-66110017 CAGCAGGACAAGGGTGCAGAGGG + Intronic
1128868859 15:71136975-71136997 CACCAGGAGGAGGCAGCAGCAGG - Intronic
1128930628 15:71702130-71702152 CAGCAGGAAGAGCAAGCAGATGG - Intronic
1128990636 15:72256949-72256971 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1128998179 15:72312173-72312195 CATCAGGAAGAGGCTGCAGGAGG + Intronic
1129369175 15:75077634-75077656 CATCAGGGTGAGCCTGCACCAGG + Intronic
1129375041 15:75124568-75124590 CATCAGGGTGAGCCTGCACCGGG - Intergenic
1131091485 15:89627810-89627832 CCGCTGGACCAGCCTGCTGCGGG + Exonic
1131184690 15:90264717-90264739 CAGAAGGACAAGCCAGCAGAAGG + Exonic
1131554289 15:93383397-93383419 CAGCAGGTTGGCCCTGCAGCTGG + Intergenic
1202975057 15_KI270727v1_random:283045-283067 CAGCATGCCCAACCTGCAGCAGG + Intergenic
1132654865 16:1037486-1037508 GGGCAGGAGGAGCCTGCGGCTGG + Intergenic
1133325791 16:4941392-4941414 CACCAGGAAGACCCTGCAGCTGG + Intronic
1134018613 16:10906611-10906633 CAGCAGCAAGAGCCTGGAGCGGG + Exonic
1135023822 16:18984096-18984118 CGGCAGGCCCAGCCGGCAGCCGG + Exonic
1136113303 16:28078630-28078652 GAGCAGGAGGAGGCAGCAGCGGG + Intergenic
1137770297 16:51011104-51011126 CAGCTGGATAAGCCTACAGCTGG + Intergenic
1138122351 16:54410853-54410875 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1138146884 16:54620627-54620649 CAGAAAGACTAGCCAGCAGCTGG + Intergenic
1139335225 16:66226636-66226658 CAGCAGGCCGAGCCTCAAGCAGG - Intergenic
1139463027 16:67137751-67137773 CAGCAGGAGGAGCCTGTCGAGGG + Intronic
1139514479 16:67445230-67445252 CGGCAGCACGGGGCTGCAGCAGG + Intronic
1139580429 16:67870154-67870176 CACCAGGAAGAACCTGAAGCCGG - Intronic
1139813305 16:69642023-69642045 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1139905465 16:70362649-70362671 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1140209831 16:72961194-72961216 CAGCAAGCCGAGACGGCAGCTGG + Intronic
1140461370 16:75142404-75142426 CAGCAGGACGTTTCAGCAGCTGG - Intergenic
1140475643 16:75238179-75238201 CACCAGCACCAGCCTGAAGCGGG + Intronic
1141955021 16:87364931-87364953 CAGGAGGTCGAGCCTGCAGTGGG + Intronic
1142044365 16:87915613-87915635 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1142146437 16:88494756-88494778 CAGCAGGAGGAGCCGGCAGGAGG + Intronic
1142365176 16:89646334-89646356 GAGCAGGACGGGGCAGCAGCAGG + Intronic
1142384761 16:89756549-89756571 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1142405558 16:89887105-89887127 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1142432851 16:90039904-90039926 CAGCAGGCCGAGCTTGCAGGTGG - Intronic
1142485902 17:247557-247579 CAGGAGGTGGAGGCTGCAGCGGG - Intronic
1142694858 17:1628096-1628118 CAGCGGTACGAGCCGGCCGCGGG - Exonic
1142848756 17:2694403-2694425 CAGGAGTGGGAGCCTGCAGCAGG + Intronic
1144047563 17:11467600-11467622 CAGCAGGACCAGCCCTCATCAGG + Intronic
1144670668 17:17130975-17130997 CAGCAGGACGACTCTGGATCTGG - Intronic
1144758039 17:17692088-17692110 CAGCAGGATGTGGCTGGAGCTGG + Intronic
1146800507 17:35816033-35816055 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1147428528 17:40357459-40357481 CCGCAGGACGGGCCTACAGGGGG + Intronic
1148886743 17:50779189-50779211 CAGGAGATCAAGCCTGCAGCAGG - Intergenic
1149925364 17:60697114-60697136 CAGGAGGTCGAGGCTTCAGCAGG + Intronic
1150414218 17:64974276-64974298 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1150722927 17:67628729-67628751 CAGCACGCAGTGCCTGCAGCAGG + Intronic
1150797424 17:68249377-68249399 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1151327441 17:73387999-73388021 CAGCAGGCCGATGGTGCAGCAGG - Exonic
1151822842 17:76506434-76506456 CAGCAGGGAGAGTCGGCAGCGGG + Intergenic
1152168610 17:78727658-78727680 CAGCAGGGCAAGGCTGGAGCAGG + Intronic
1152217749 17:79044253-79044275 CTGCAGGACCAGCCTCCAGCAGG - Intronic
1153689282 18:7575258-7575280 CAGCAGGAGCAACCGGCAGCAGG - Intronic
1153944928 18:10009858-10009880 CAGCAGGACAGGCCTGCACGGGG - Intergenic
1155467322 18:26152396-26152418 CAGAAGGTCGAGGCTGCAGTGGG - Intronic
1155877188 18:31101912-31101934 CAGCAGGAGCAGCCGGCAGAGGG + Exonic
1156490562 18:37493525-37493547 CAGCAGGAAGTGGCTGCTGCAGG + Intronic
1156505624 18:37589435-37589457 CACAGAGACGAGCCTGCAGCTGG + Intergenic
1160016109 18:75141857-75141879 CAGCCAGGAGAGCCTGCAGCAGG - Intergenic
1160230545 18:77045376-77045398 CAGCAGCACCTGCCTGCACCAGG + Intronic
1160384170 18:78485037-78485059 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384198 18:78485162-78485184 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384237 18:78485373-78485395 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384272 18:78485539-78485561 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384333 18:78485832-78485854 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384385 18:78486084-78486106 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384404 18:78486168-78486190 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384447 18:78486379-78486401 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384466 18:78486463-78486485 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160631629 18:80250479-80250501 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1160759881 19:778249-778271 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1160760952 19:784088-784110 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1160848812 19:1179736-1179758 CAGCAGGCAGAGGCTGCAGTGGG - Intronic
1161006479 19:1939798-1939820 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1161351820 19:3797368-3797390 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1162000812 19:7743890-7743912 CTGCAGGAGGAGCCTGCCACCGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162697239 19:12485744-12485766 CAGAAGGTCGAGGCTGCAGGGGG - Intronic
1163433730 19:17282978-17283000 CAGGAGCCCGAGCCTGCACCTGG + Exonic
1163800512 19:19362191-19362213 CAGCATGACGAGCCTGCCATGGG + Intergenic
1164602689 19:29573688-29573710 CAGCTGGCCGAGGCTGCAGAGGG - Intergenic
1165302837 19:34982690-34982712 CAGCAGGAGAATCATGCAGCTGG - Intergenic
1165305762 19:35001679-35001701 CAGCAGGAGGAGGTTGCAGTGGG - Intronic
1165455497 19:35908190-35908212 CAGGAGCAGGAGCCTGCTGCAGG + Exonic
1166679519 19:44758304-44758326 CAGCGGGAGGAGCCCGCGGCCGG - Exonic
1168319129 19:55498651-55498673 CAGCATGAGGACCCTGCACCTGG - Intronic
925027265 2:619957-619979 CAGGAAGAGGGGCCTGCAGCAGG + Intergenic
925989905 2:9246359-9246381 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
926054595 2:9767173-9767195 CAGAAGGTCGAGGCTGCAGGGGG - Intergenic
926188770 2:10711749-10711771 CAGGAGGACAAGGCTGCAGTGGG + Intergenic
928213633 2:29342954-29342976 CAGGAGGCAGAGCTTGCAGCGGG - Intronic
929775772 2:44929680-44929702 CCGCAGGCCGAGCCCGCGGCCGG + Intergenic
930090671 2:47529088-47529110 CAGCAGGAAAAGTCTCCAGCGGG - Intronic
930872563 2:56183946-56183968 CTGGAGGAGGAGCCTGGAGCTGG - Intergenic
932246661 2:70202350-70202372 CCACAGGGTGAGCCTGCAGCAGG - Intronic
932453953 2:71834423-71834445 CAGCAGGCCCAGCCAACAGCTGG - Intergenic
933157762 2:78993591-78993613 CAGCAGGGAGAGCAAGCAGCAGG - Intergenic
934663315 2:96154470-96154492 CAGCAGGGAAGGCCTGCAGCTGG + Intergenic
935139482 2:100340075-100340097 CAACAGGACAAGCTGGCAGCTGG - Intergenic
936093699 2:109516420-109516442 CAGAAGCACGGGCCTACAGCTGG + Intergenic
940752218 2:157639020-157639042 CAGGAGAATGAGCCTGGAGCAGG - Intergenic
941837443 2:170040210-170040232 CAGGAGGTCAAGGCTGCAGCGGG - Intronic
941910024 2:170755750-170755772 CAGGAGGTCGAGTCTGCAGTGGG + Intergenic
942799617 2:179861003-179861025 CCGCAGAGCGAGCCTGCACCTGG - Intronic
944402289 2:199341931-199341953 CTGCAGGACCAGGCTGAAGCTGG - Intronic
945368835 2:208991149-208991171 CAGGAGGAGGAGCTTGCAGTGGG - Intergenic
945415060 2:209560551-209560573 CAGGAGGTCAAGCCTGCAGAGGG - Intronic
945628576 2:212241181-212241203 CAGGAGGTTGAGGCTGCAGCGGG + Intronic
946311509 2:218884644-218884666 CAGGAGGATGAACCTGCAGGTGG - Intronic
947890804 2:233617678-233617700 CTGCAGCCCGAGCCAGCAGCTGG - Exonic
947892418 2:233636493-233636515 CTGCAGCCCGAGCCAGCAGCTGG - Exonic
947950003 2:234138966-234138988 CAGCAGGTCAAGCCTGGAGATGG - Intergenic
948107794 2:235428988-235429010 CAGCAGGAGGAGACTGCTGGTGG + Intergenic
1168814912 20:729618-729640 CAGGAGGCAGAGGCTGCAGCGGG + Intergenic
1171029354 20:21663376-21663398 CAGAAGGAGGAGCCTGGAGAAGG + Intergenic
1171103350 20:22407721-22407743 CCACAGGAGGAGACTGCAGCAGG + Intergenic
1172265587 20:33610213-33610235 CAGGAGGTCGAGGCTGCACCAGG + Intronic
1172390010 20:34559726-34559748 CTGCAGGCGGCGCCTGCAGCCGG - Exonic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174445133 20:50585841-50585863 CAGCAGTACCAGCCTAGAGCAGG - Intergenic
1175161897 20:57014535-57014557 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1177651997 21:23969152-23969174 TCACAGGGCGAGCCTGCAGCGGG + Intergenic
1178141544 21:29689779-29689801 CAGCAGGGCGATCCTGGATCTGG - Exonic
1179809868 21:43864278-43864300 CAGGAGGCGGAGCCCGCAGCGGG + Intergenic
1180663455 22:17489527-17489549 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1181643447 22:24217041-24217063 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1181931127 22:26402464-26402486 CAGGAGGTCAAGCCTGCAGTGGG + Intergenic
1183064268 22:35352764-35352786 GTGCAGGGCCAGCCTGCAGCAGG - Intergenic
1183501476 22:38181987-38182009 CAGGAGGACGAGCTTTCGGCGGG + Intronic
1183611176 22:38907444-38907466 GAGCAGGAGGATTCTGCAGCTGG - Intergenic
1184727864 22:46356877-46356899 CAGCGGGAAGATCCTGCGGCTGG + Exonic
1185045243 22:48525394-48525416 CAGCAGGCGGAGCAGGCAGCGGG - Intronic
950447559 3:13047127-13047149 CCCAAGGACCAGCCTGCAGCCGG - Intronic
950893024 3:16421911-16421933 GAGCAGGAGGGGCCTGCAGAAGG - Intronic
952876767 3:37951605-37951627 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
954579346 3:51694812-51694834 CAGCAGGGAGAGCCTGCAGAAGG - Intronic
954937848 3:54343363-54343385 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
955184970 3:56706195-56706217 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
956678480 3:71755707-71755729 CAGCACAAGGACCCTGCAGCCGG - Exonic
957821947 3:85388100-85388122 CAGGAGGTCGAGGCTGCAGTAGG - Intronic
957959124 3:87227157-87227179 CAGCGGGGCGAGTCTGGAGCTGG - Intergenic
959048867 3:101504989-101505011 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
961674638 3:128557125-128557147 CAGCTGGACGGGGCTGCAGCTGG - Intergenic
962290311 3:134130670-134130692 CAGAAGGAGAAGCCTGCAGCTGG + Intronic
962290974 3:134136095-134136117 CAGCCTGAGGAGCCTGCAGTGGG + Intronic
962694048 3:137930077-137930099 CAGCAGGCGGAGGCTGCAGTGGG + Intergenic
963810466 3:149771837-149771859 CAGCAGGGGGAGTCTGGAGCTGG - Intronic
964160709 3:153641425-153641447 CACCAGTACCAGCCTGGAGCTGG + Intergenic
965274415 3:166662909-166662931 CAGCATGAAGAGTCTGCACCAGG - Intergenic
968094117 3:195916003-195916025 CAGCAGTTCGAGGCTGCAGTGGG + Intergenic
968422767 4:499280-499302 CAGCAGGGCGAGGCTCCAGGTGG + Exonic
968982310 4:3856907-3856929 CAGCAGGACTGACCTGCTGCGGG - Intergenic
970387368 4:15569055-15569077 CACCAGGACAAGCCAGCAGAGGG + Intronic
971039779 4:22738836-22738858 CAGCAGGACAGGCCTTCAGCAGG - Intergenic
972301201 4:37787304-37787326 CAGCAGGCGGACCCTGCACCTGG - Intergenic
973962832 4:56129147-56129169 CAGGAGGTTGAGGCTGCAGCAGG - Intergenic
974863170 4:67548200-67548222 CAGCAGGTAGAGGCTGCAGTGGG - Intergenic
977749774 4:100595527-100595549 CAGCAGGTTGAGCATTCAGCAGG - Intronic
978856526 4:113400686-113400708 CAGCATGACGACCCTGGACCTGG - Intergenic
981790975 4:148536104-148536126 CAGGAGGCCGAGGCTGCAGTGGG - Intergenic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985752296 5:1687550-1687572 CTGCAGGGCAAGCCTGCACCCGG + Intergenic
988253480 5:28791955-28791977 CAGGAGCAGAAGCCTGCAGCTGG - Intergenic
991666056 5:69001071-69001093 CAGCAGGATGAGGCAGTAGCTGG - Intergenic
991974339 5:72171514-72171536 CAGGAGGTCGAGGCTGCAGGGGG + Intronic
991999216 5:72418759-72418781 CGGGAGGACGAGCTTGCAGCGGG - Intergenic
996183229 5:120446279-120446301 AAGCAGGACAACCCTGGAGCAGG + Intergenic
996866545 5:128130439-128130461 CAGCAGGTGGAGGCTGCAGTGGG + Intronic
996887958 5:128381672-128381694 CAGAAAGACAAGCCTGCTGCTGG + Intronic
997111458 5:131079494-131079516 CAGGAGCAAAAGCCTGCAGCTGG + Intergenic
997583830 5:135033470-135033492 CAGATGCACGAGCCTACAGCTGG - Exonic
997818037 5:137036740-137036762 CAGCAGGAACTGCCTGGAGCAGG - Intronic
998395136 5:141813355-141813377 CAGGAGGTCGAGGCTGCAGTAGG - Intergenic
999080348 5:148837652-148837674 GCGCAGGATGAGCCTGCAGGAGG + Intergenic
1001593906 5:172885691-172885713 CAGCAGGAAAGGGCTGCAGCGGG - Intronic
1002292810 5:178211260-178211282 CAGCTGGAAGAGCCTGCTGCAGG - Intronic
1003324360 6:5081516-5081538 GAGGAGGATGAGCCTGCAACAGG - Intergenic
1004770706 6:18777878-18777900 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1005850184 6:29814995-29815017 CAGCAGGAGGAGGCCACAGCTGG + Intergenic
1006072525 6:31507742-31507764 CAGCAGGAGGAGGCCACAGCTGG - Intronic
1006805524 6:36786230-36786252 TAGGAGGAGGAGCCTGGAGCTGG + Intronic
1007018678 6:38496573-38496595 CAGGAGGTTGAGGCTGCAGCAGG + Intronic
1007633375 6:43284757-43284779 CTGCTGGAAGAGCCTGCTGCTGG - Intronic
1007634121 6:43287723-43287745 CAGGGGGAGGAGGCTGCAGCTGG - Exonic
1008358882 6:50591355-50591377 CATCAGGTAGAGCCTGCTGCAGG - Intergenic
1009865775 6:69395915-69395937 CTGCAGGGCAAGCCAGCAGCTGG - Intergenic
1010756242 6:79669136-79669158 CAGAAGGACCAGCGTGCAGGAGG - Intronic
1013782207 6:113741313-113741335 CAGGAGGAAGAGGCTGCAGTGGG + Intergenic
1014645528 6:123968054-123968076 CAGCAGGTGGAGCAGGCAGCTGG + Intronic
1015544045 6:134344268-134344290 CAGCAGGTCAAGACTGCAGTGGG - Intergenic
1018830021 6:167435045-167435067 CAGCATGTAGAGGCTGCAGCAGG - Intergenic
1019261447 7:84174-84196 CAGCAGGCTGAGCCTTCAGGGGG + Intergenic
1024616874 7:51122903-51122925 CAGGAGGAGGAGGCTGCAGTAGG + Intronic
1025278265 7:57604218-57604240 CAGCAGGTGGAGGCTGCAGTGGG - Intergenic
1025927404 7:65970813-65970835 CAGAAGGAGGAGTCTGCAGTGGG + Intronic
1026086596 7:67268063-67268085 GAGCAGCGGGAGCCTGCAGCAGG + Intergenic
1027059320 7:75073280-75073302 CGGCAGGACGACCCTCGAGCTGG - Intronic
1028134911 7:87215219-87215241 CAGTGGTGCGAGCCTGCAGCTGG + Intronic
1031415256 7:121488462-121488484 CAGGAGGACACACCTGCAGCAGG + Intergenic
1031729268 7:125277611-125277633 CAGGAGGCCGAGGCTGCAGTCGG + Intergenic
1031774914 7:125896213-125896235 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1031892425 7:127310230-127310252 CAGGAGGCAGAGCCTGCAGTGGG + Intergenic
1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG + Intergenic
1032703723 7:134404378-134404400 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1033158150 7:138973716-138973738 CAGCAGGTTGAGGCTGCAGTGGG - Intronic
1035360807 7:158313249-158313271 CAGGAGGACGACCCTGTGGCAGG - Intronic
1035777833 8:2203252-2203274 CAGCACCACCAACCTGCAGCCGG - Intergenic
1037185639 8:16059078-16059100 CAGCATGACTAGCCTGAAGAGGG + Intergenic
1037570159 8:20151043-20151065 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1037920459 8:22802046-22802068 CAGCAGGAAGGGACTTCAGCAGG - Intronic
1039534219 8:38293474-38293496 CAGCAGGCAGAGGCTGCAGTGGG + Intronic
1039641534 8:39228020-39228042 CACCAGTACCAGCCTGGAGCTGG + Intronic
1040517041 8:48143864-48143886 CAGGAGGTTGAGGCTGCAGCAGG + Intergenic
1040729460 8:50425246-50425268 CAGCAGGAGGTGACTGCTGCTGG + Intronic
1042510587 8:69607436-69607458 CAGGAGGGCGAGGCTGCAGTGGG - Intronic
1044665619 8:94631908-94631930 CAGGAGGTCGAGGCTGCAGTAGG - Intergenic
1045674852 8:104595892-104595914 CAGCAAGAGGAGCCTGTACCAGG - Intronic
1047582809 8:126235441-126235463 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1047749068 8:127866424-127866446 GAGCAGGACAAGCCACCAGCAGG - Intergenic
1047966880 8:130051481-130051503 AAGCAGGCCGAGACTGCGGCAGG - Intergenic
1049195889 8:141315426-141315448 CAGCAGGTGGGGCCTGCCGCAGG - Intergenic
1049480711 8:142821147-142821169 CAGCAAGGCCAGCCTGCAGAAGG + Intergenic
1050438042 9:5629618-5629640 CTGGAGGACGTGCCTGCAGCCGG - Intronic
1051546299 9:18279876-18279898 CACCAGGACCAGCCTGGTGCTGG + Intergenic
1053016012 9:34662595-34662617 CAGCAGCAGGAGGCTGCAGAAGG + Exonic
1056117669 9:83456904-83456926 CAGAAGGTCGAGGCTGCAGTGGG + Intronic
1057015130 9:91644633-91644655 CAGCAGGACCAGTGTGCATCTGG - Intronic
1057552551 9:96062759-96062781 TAGGAGGTCGAGACTGCAGCCGG - Intergenic
1058699306 9:107587720-107587742 CAGCAGTATCAGCCTGGAGCCGG + Intergenic
1060254978 9:122019521-122019543 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1060300838 9:122373750-122373772 CAGCTGGAAGAGCCTGCTGGTGG - Intronic
1060604214 9:124899619-124899641 CAACAGGCAGAGCCTGCAGGGGG - Intronic
1060881987 9:127123788-127123810 CAGGAGGACAGGCCTGCTGCCGG + Intronic
1061875105 9:133539680-133539702 AAGCAGGAAGTGGCTGCAGCCGG - Intronic
1062377148 9:136267315-136267337 CAGCAGGGCGGGGCTACAGCAGG + Intergenic
1062443027 9:136579510-136579532 CAGCAGGGTGAGCCTCCTGCAGG + Intergenic
1062568048 9:137171927-137171949 CAGGAGGAGGCACCTGCAGCAGG + Exonic
1187442553 X:19333122-19333144 CACCAGAAAGAGCCTCCAGCTGG + Intergenic
1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG + Intergenic
1194041719 X:88949498-88949520 GAGAAGGAAGAGCCTGCAGTTGG + Intergenic
1194707496 X:97193084-97193106 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1195473850 X:105262069-105262091 CAGCTGCACGAGCCAGCAACTGG - Intronic
1196071710 X:111531087-111531109 CAGGAGGTCGAGGCTGCAGAGGG - Intergenic
1196529752 X:116771672-116771694 CAGTAGGATGAGGCTGCAGTGGG + Intergenic
1196666490 X:118322413-118322435 CAGGAGGTCGAGGCTGCAGGGGG + Intergenic
1197651192 X:129066374-129066396 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1197723648 X:129761429-129761451 CAGCAGGACTGGCCTGCTGCTGG - Intronic
1202136518 Y:21671018-21671040 CAGGAGGCCGAGCTTGCAGTGGG - Intergenic
1202255977 Y:22920536-22920558 CAGCAGGGACAGACTGCAGCAGG + Intergenic
1202408968 Y:24554289-24554311 CAGCAGGGACAGACTGCAGCAGG + Intergenic
1202461815 Y:25115789-25115811 CAGCAGGGACAGACTGCAGCAGG - Intergenic