ID: 903076342

View in Genome Browser
Species Human (GRCh38)
Location 1:20769951-20769973
Sequence CTCTAGGAATGGGGTGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903076342 Original CRISPR CTCTAGGAATGGGGTGAACT AGG Intronic
903076342 1:20769951-20769973 CTCTAGGAATGGGGTGAACTAGG + Intronic
905309943 1:37042408-37042430 CTCTGGGGATGGGGAGATCTTGG - Intergenic
905460839 1:38121826-38121848 GTCTAGGAATTGGGTGGTCTAGG + Intergenic
910659026 1:89650868-89650890 CTCTAAGAAGTGGTTGAACTTGG - Intronic
911186586 1:94910680-94910702 CACAAGAAATGGGGTGACCTGGG - Intronic
911581067 1:99634076-99634098 CTCTAGGACTGGTGTGGCCTGGG - Intergenic
915626299 1:157115961-157115983 TTCTAGGCATGGGCTGAGCTGGG + Intergenic
915720019 1:157978130-157978152 TGCTAGGAAAGGGGTGAGCTTGG - Intergenic
919584754 1:199422467-199422489 CTCTAAGAGTGGGTGGAACTTGG + Intergenic
920118584 1:203638631-203638653 GTCTTGGAGTGGGGAGAACTAGG - Intronic
922332324 1:224588064-224588086 ATCTAGGAATGGGGTGAGATGGG - Intronic
923308274 1:232708765-232708787 CTCTAGGAATTTAGAGAACTAGG + Intergenic
1063935299 10:11071424-11071446 ATCTAGGAAGAGGGAGAACTGGG + Intronic
1064994189 10:21282033-21282055 CTATAGGAATGGGAAGAAATTGG - Intergenic
1070991594 10:80737946-80737968 CTCGAGGAATGGGTAGGACTGGG - Intergenic
1072761518 10:98060750-98060772 TTCTAGGAATTGGGTGAGCAGGG + Intergenic
1078059511 11:8034099-8034121 CTCTTGGAATGGCCTGAGCTGGG - Intronic
1078077435 11:8174591-8174613 CTCTGGGAGTTGGGAGAACTGGG - Intergenic
1078364143 11:10692874-10692896 CTCTAGGAATCGCTTCAACTCGG + Intronic
1079667559 11:23125909-23125931 CTCCAGAAATGGGCTGATCTTGG - Intergenic
1080880312 11:36313582-36313604 CTCTAAGAATGGAGGGACCTGGG + Intronic
1081613592 11:44577881-44577903 CTCTAGGTAGGGGGTGTCCTCGG + Intronic
1083594943 11:63914736-63914758 GTCAGGGAATGGGGTGAAGTTGG + Exonic
1084985520 11:72867590-72867612 CTCTATGAATGGGATGAGTTTGG + Intronic
1085417098 11:76326337-76326359 CTCTTGAGATGGGGTGAAGTGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093327495 12:17795616-17795638 CTTTAGTAATGGAGAGAACTAGG + Intergenic
1093798006 12:23336951-23336973 TTCTAGGAATGGAGTGAGTTTGG + Intergenic
1094358189 12:29601088-29601110 CTCTAGGAATAGGCTGATTTGGG - Intronic
1094675484 12:32615962-32615984 CTCTAGGAATCGGGTAATCCTGG + Intronic
1095360563 12:41333430-41333452 CTCCATGAATGGGGAGAGCTTGG + Intronic
1098086830 12:66854467-66854489 CTCTAGGAATGGTGTGGAGGGGG + Intergenic
1099934424 12:89108394-89108416 CTCCAGGAAGGGGGAGAGCTTGG - Intergenic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1101325936 12:103716047-103716069 CTTTGGGAATGAGGTGAAATGGG + Intronic
1101679118 12:106947593-106947615 CTGAAGGAATTGGCTGAACTTGG - Intergenic
1104090387 12:125511961-125511983 CTCTAGCCATGGGCTGGACTTGG - Intronic
1105436449 13:20382545-20382567 ATCTAATAATGGGGTGATCTTGG + Intergenic
1106912046 13:34473208-34473230 ACCTGGGAATGGTGTGAACTCGG - Intergenic
1108266237 13:48711774-48711796 ATCTGGGAAAGGGGTGAAATGGG + Intergenic
1119684554 14:76621169-76621191 CTCTGTGTATGAGGTGAACTTGG - Intergenic
1121268685 14:92622958-92622980 CTATAGGATTGGGAAGAACTAGG + Intronic
1126124214 15:45280540-45280562 ATCCAGGAACGGGGGGAACTAGG + Intergenic
1129446945 15:75625416-75625438 TTCTAGGCATGGGGTCATCTAGG + Exonic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1133407021 16:5532767-5532789 CTCCTGGATTGGGGTGAATTGGG + Intergenic
1133926043 16:10193194-10193216 CCCAAGGAATGGGAGGAACTAGG - Intergenic
1136590716 16:31216241-31216263 AGCTAGGACTGGGCTGAACTGGG - Intronic
1137349116 16:47695328-47695350 CTCTAGCAATGGGCTTAACGGGG - Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1141236470 16:82222463-82222485 AACTAGGAATGGGGTCAACTGGG + Intergenic
1143217864 17:5238688-5238710 CTCCAGAAATGGGGAGAAGTGGG - Intergenic
1144832961 17:18141940-18141962 CTGGAGGGATGGGGTGGACTTGG - Intronic
1145714879 17:27010001-27010023 TCCTAGGAATGGGCTGGACTTGG + Intergenic
1145965963 17:28917503-28917525 CACAGGGAATGGGGTTAACTGGG - Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1148891276 17:50809089-50809111 GTCTTGGAGTTGGGTGAACTTGG + Intergenic
1152423434 17:80206067-80206089 CTCTGGGGATGAGGTGAACTTGG - Intronic
1153562876 18:6388960-6388982 CTCTAGGGAATGGGTAAACTAGG + Intronic
1155800054 18:30089852-30089874 CTCTTGCAATGGGTTGAACATGG + Intergenic
1156523155 18:37739108-37739130 TTCTAGGAATGGGGCGGACAGGG + Intergenic
1158498226 18:57975811-57975833 CTCTAGGTATTAGGTGAACTTGG + Intergenic
1159040238 18:63318234-63318256 CTTCAGGGACGGGGTGAACTGGG - Exonic
1160036395 18:75305293-75305315 TTCTGGGAAGGGTGTGAACTCGG - Intergenic
1162546821 19:11335826-11335848 CTCTAAGACAGGGGTGGACTGGG - Intronic
1162756889 19:12866052-12866074 CTCTAGGTGGGGGATGAACTCGG - Exonic
1162758691 19:12875327-12875349 AGCTAGGAAGGGGATGAACTGGG + Exonic
1165142724 19:33712175-33712197 CTCTAGGAGTGGGCTCTACTGGG - Intronic
1166230776 19:41424898-41424920 CTCTGGGCATGGGGTGGACATGG + Exonic
1168246077 19:55113765-55113787 CCCTGGGAACGGGATGAACTCGG + Intronic
925940960 2:8817900-8817922 CACTAAGAATGGGGTAAACATGG + Intronic
928043117 2:27898358-27898380 TTATTGGAATGGGGTGAGCTTGG + Intronic
929976435 2:46639867-46639889 CTCTAGAAGTGGCGTGAATTGGG - Intergenic
930767272 2:55096877-55096899 CTCAAGGAATGAGGTGTAGTTGG + Intronic
931553887 2:63478040-63478062 CTCAAGGGAGGGGGTGAATTGGG + Intronic
932094137 2:68831987-68832009 CTCTGGGAATGGGGTTGCCTTGG + Intergenic
935338042 2:102035028-102035050 CTCTAGGAATTGGCTAAACCAGG + Intergenic
939451327 2:142378652-142378674 TTCTAGGAATGGAGTTATCTGGG - Intergenic
944037361 2:195311011-195311033 CTTTAGGAATGGGTTGAGGTGGG - Intergenic
1170730075 20:18966261-18966283 CTCTAGGCGTGGAGTGAACCAGG + Intergenic
1172198108 20:33105867-33105889 CACTAAGAGTGGTGTGAACTTGG + Intronic
1177292746 21:19136297-19136319 CTTTATAAATGGAGTGAACTAGG + Intergenic
1178600558 21:33990856-33990878 CTCTGGGAATGGTGAGAGCTGGG + Intergenic
1179113018 21:38463627-38463649 CTTGAAGAATGGGGTGTACTGGG + Intronic
1182904352 22:33922241-33922263 CTCGAGGAGTGGGGTCAGCTGGG - Intronic
1184858777 22:47161332-47161354 CTCTTGGTATGGGGGGCACTGGG + Intronic
949213502 3:1535850-1535872 CTCTTGGAATAGTGTGACCTTGG - Intergenic
949853911 3:8442528-8442550 AGCTAGGAAGGGGCTGAACTAGG + Intergenic
950011812 3:9729502-9729524 GTCTCGGAATGGGACGAACTGGG - Exonic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
951421204 3:22487725-22487747 CAATAGAAATGGGGTGAAATAGG - Intergenic
955311231 3:57888804-57888826 TTTTAGGAATGGAGTGAAGTAGG + Intronic
956021335 3:64936568-64936590 CTATAGAAATAGGGTGAAATGGG - Intergenic
961339110 3:126205372-126205394 CTCTAGGAAGAGGGTGCACCTGG + Intergenic
969548123 4:7845498-7845520 CACTAGGAATGGGCTGAAGAAGG + Intronic
970126293 4:12815960-12815982 CTCTATGGATGGGGTGTACTTGG - Intergenic
972017124 4:34261730-34261752 CTCTAGGAATGTGGTGATGCAGG - Intergenic
973792439 4:54390899-54390921 TTCCAGGAAGGGGGAGAACTGGG + Intergenic
977050924 4:92128150-92128172 CTCTAGGAATGTGGAGATGTAGG - Intergenic
981303662 4:143221681-143221703 CTTTAGGAAGGGGGATAACTGGG - Exonic
988995497 5:36711111-36711133 GTCTAGAAATTGGGTGAAGTTGG + Intergenic
989014221 5:36910534-36910556 ATCTAGGTATGAAGTGAACTAGG - Intronic
989262795 5:39437391-39437413 CTCTAGGGGTGGGAGGAACTGGG - Intronic
990563262 5:57004447-57004469 CTCTAGGAACAGGGTGAATCAGG + Intergenic
992861877 5:80919575-80919597 GGCTAGGAATGGGGTGAGCAAGG - Intergenic
993377697 5:87169019-87169041 CCCTAGAAATGGGGGGATCTGGG - Intergenic
998356969 5:141546768-141546790 CTCTAGGAACAGGGTGAAAGAGG + Intronic
1003450163 6:6223362-6223384 TTGTAGGCATGGGGAGAACTTGG + Intronic
1003642455 6:7887400-7887422 CTCGAGGAAAGGGATGAGCTTGG - Intronic
1006544869 6:34771902-34771924 TTTTAGGGATGTGGTGAACTGGG + Intronic
1007390498 6:41547269-41547291 CTCTGGGAATGGGGTGTACGGGG + Intronic
1010450528 6:75997138-75997160 ATCTAGGGATGAGGTGAAATTGG + Intronic
1014465951 6:121757122-121757144 TTCTAGGGATGGAGTGAACAGGG + Intergenic
1016318467 6:142816337-142816359 TTCTGGAAATGGGCTGAACTGGG - Intronic
1016454974 6:144221392-144221414 CTCTAGGAATTAGCTGACCTTGG + Intergenic
1019711947 7:2521858-2521880 CTGCAGGCATGGGGTGAACCCGG + Intronic
1024943501 7:54785744-54785766 CACTAGGAAGGGGGTGGGCTTGG - Intergenic
1025035918 7:55592390-55592412 CTCTGGGAATGGGGTATCCTGGG + Intergenic
1027642148 7:80749438-80749460 CTTTAGGAATGGGATAAACCTGG - Intronic
1030624452 7:111829361-111829383 CTCAAGTAATTGGGAGAACTAGG - Intronic
1034009820 7:147517398-147517420 CTAAAAGGATGGGGTGAACTTGG + Intronic
1034024124 7:147679670-147679692 CTCCTGGAATGGGGTCAAGTGGG - Intronic
1037903275 8:22700727-22700749 CTTTAGGAAGGGGTTGGACTGGG + Intergenic
1041432565 8:57799665-57799687 CTCTTGAAATGGGGGCAACTGGG - Intergenic
1043381429 8:79706305-79706327 CTCTGGGAGTGGGGAGACCTGGG + Intergenic
1045102774 8:98862040-98862062 CTCAAGGATTTGGGTGAATTGGG - Intronic
1048350512 8:133612049-133612071 CTCTGGGAATGGGATGGAGTAGG + Intergenic
1053420148 9:37972267-37972289 CTCTGGGCATGGGAGGAACTGGG - Intronic
1058849811 9:109000743-109000765 TTCAAGGAATGAGGTGAAGTCGG + Intronic
1060287935 9:122271098-122271120 CTATAAGAAAGGGGTGAAGTAGG - Intronic
1060856295 9:126916476-126916498 CTCTTGGAATGTGGTAAAATCGG - Intronic
1187633935 X:21205901-21205923 GGCTAGGAAAGGGGTGAAGTGGG - Intergenic
1189364783 X:40380143-40380165 CTCTAGGAAAGTGGTGTACAGGG - Intergenic
1189751706 X:44229251-44229273 CTCCAGGAATGTGATGAAGTTGG - Intronic
1190105793 X:47560638-47560660 CTTTAGGAATGGGGTTGATTAGG - Intergenic
1195307832 X:103603159-103603181 CTCTAAGAATGGGCAGGACTAGG + Intergenic