ID: 903077089

View in Genome Browser
Species Human (GRCh38)
Location 1:20779289-20779311
Sequence GGAGTACTAATGCTCCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903077089_903077094 30 Left 903077089 1:20779289-20779311 CCATAAAGGAGCATTAGTACTCC 0: 1
1: 0
2: 0
3: 1
4: 67
Right 903077094 1:20779342-20779364 GTTATGCTCCCACCACTGACTGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903077089 Original CRISPR GGAGTACTAATGCTCCTTTA TGG (reversed) Intronic
903077089 1:20779289-20779311 GGAGTACTAATGCTCCTTTATGG - Intronic
903296868 1:22349399-22349421 GCAGTCCTAATGCTCCTTGCTGG + Intergenic
909120324 1:71595210-71595232 GGAGCACTAATGCTCCACTCTGG - Intronic
917019152 1:170567693-170567715 GGATTTCTAATGCTCCGTTGAGG + Intergenic
920316863 1:205082687-205082709 AAAGTACTAATCCTCCTTTGGGG + Intergenic
924413787 1:243835717-243835739 GGAGTGGTAATTCTCCTATAGGG - Intronic
1067496544 10:46765662-46765684 GGAGTATTTCTGCACCTTTACGG - Intergenic
1067598111 10:47574740-47574762 GGAGTATTTCTGCACCTTTACGG + Intergenic
1078936764 11:15958173-15958195 GGAGGACTGATTTTCCTTTAGGG + Intergenic
1081244041 11:40742052-40742074 GAAGTGATAATGCCCCTTTATGG - Intronic
1088018545 11:105090425-105090447 GGAGTACTGAAGCTCCATTCTGG - Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1090342714 11:126039708-126039730 AGAGTGATAATGCTGCTTTAGGG - Intronic
1092947223 12:13467937-13467959 GGATAACTAATACTCATTTAAGG - Intergenic
1094702396 12:32882257-32882279 AAAGTACTAATGGTCATTTATGG + Intronic
1096153022 12:49326241-49326263 GGAGTCCTAAAGCTCCTGGAAGG - Intronic
1099593655 12:84628641-84628663 GTATTATTTATGCTCCTTTAAGG + Intergenic
1105480993 13:20775600-20775622 GGAGTACTTATTCTCATTAAAGG + Intergenic
1109021609 13:57102108-57102130 ATAATACTAATGCTCTTTTAAGG + Intergenic
1127395478 15:58541122-58541144 GGACTCCTATTGATCCTTTAAGG + Intronic
1128844371 15:70877108-70877130 GGAATTGTAATGGTCCTTTAAGG - Intronic
1131665808 15:94570004-94570026 GGGGTACTAACGCTTCATTAAGG + Intergenic
1134252262 16:12582659-12582681 GGAGTAATACTGCTCCTTTTAGG - Intergenic
1134853888 16:17503929-17503951 GGAGCACTAATTGTCCTTGATGG + Intergenic
1147790345 17:43010340-43010362 GGAGTGCAATTGCTCCATTATGG - Intronic
1157382400 18:47231359-47231381 GGAGTCCCACTGCTCCTTGAAGG + Intronic
1160007964 18:75082214-75082236 ACAGTACTCATTCTCCTTTAAGG - Intergenic
1164759042 19:30714196-30714218 GCAGTACTAATGGTCCTCTCAGG + Intergenic
1167062329 19:47157368-47157390 GGAGTACAAAAGCTGCTTTGTGG + Intronic
929697412 2:44130697-44130719 GGAGTACTCATGTGGCTTTATGG + Intergenic
931205135 2:60139598-60139620 GGAGCAGTAATGCCCTTTTATGG - Intergenic
931980023 2:67684935-67684957 GGAGCTATAATGCTCCTTAATGG - Intergenic
937581730 2:123496278-123496300 GCAGTACTAGAGCTTCTTTATGG + Intergenic
940544721 2:155069475-155069497 GGAGTACTGCAGCACCTTTATGG - Intergenic
942606772 2:177700193-177700215 GGAGTGCCAACTCTCCTTTATGG + Intronic
945711977 2:213308179-213308201 GGAATACTAATTCTATTTTATGG - Intronic
1168792599 20:589772-589794 AGAGTCCTAATGCTACTGTATGG + Intergenic
1171873765 20:30551907-30551929 TGAGTACTAATGTTCTTTCATGG - Intergenic
1174254792 20:49246484-49246506 GGGGTTCTTGTGCTCCTTTAAGG + Exonic
1180539395 22:16428547-16428569 GGAGTTCTACTCCTCCTATATGG + Intergenic
951948340 3:28168295-28168317 GGAGCAATAATGTTCCTTCAGGG + Intergenic
958745506 3:98128978-98129000 GCAGCACTACTGCTCCTTTCTGG - Intergenic
958748313 3:98164313-98164335 GCAGTACTACAGCTCCTTTCTGG - Intergenic
961377885 3:126478988-126479010 GGAGTCCTGTTGCTCCTTTCAGG - Intergenic
963376544 3:144473337-144473359 CTAGTTCTAATGCTCCTTAAGGG - Intergenic
966780589 3:183580868-183580890 GGAGTAGCTCTGCTCCTTTAAGG + Intergenic
975321925 4:73018650-73018672 GGATTAATAATTCTCCTTTTTGG + Intergenic
976344799 4:83988267-83988289 GGAGAACTAATGCTCCAGTTAGG + Intergenic
980651096 4:135715701-135715723 AGAAAACTATTGCTCCTTTATGG - Intergenic
983250209 4:165335492-165335514 TAAGTTCTAATGCACCTTTAGGG + Intronic
984034620 4:174649903-174649925 GGAGAATTTAGGCTCCTTTAGGG - Intronic
1001684271 5:173581734-173581756 TGAACACTAATGCTCCTTTGGGG + Intergenic
1005755231 6:28920162-28920184 GCGATACTCATGCTCCTTTAAGG + Exonic
1008604647 6:53128605-53128627 GGAGTAAAAATGCTGCTTTGGGG - Exonic
1011988787 6:93485583-93485605 GGACTACTAATGCACATTGATGG + Intergenic
1014549497 6:122773307-122773329 GGAGTATTTATGGTCCTTAAAGG - Intergenic
1023544196 7:41300022-41300044 GAAGTACTAATGCTTATTGAAGG - Intergenic
1024453033 7:49570672-49570694 GGAGTTCAAATGCTCCAATAAGG + Intergenic
1026225592 7:68437302-68437324 GGAGTGCTGATGATCCCTTAAGG - Intergenic
1028810558 7:95081617-95081639 GGTTTACTAATGCACCTTTCAGG - Intronic
1028984877 7:97002003-97002025 GGAGCCCTAAGGCTCTTTTAGGG - Intergenic
1036962424 8:13259410-13259432 AGAGTGCTAAGGCTCCCTTAGGG + Intronic
1040350028 8:46555863-46555885 TGATTATTAATGCTGCTTTATGG - Intergenic
1042425407 8:68642681-68642703 GGAGTGCTAATGGTCTGTTATGG - Intronic
1047620611 8:126602703-126602725 GGTGTTCTGGTGCTCCTTTATGG + Intergenic
1052055167 9:23898031-23898053 GGATTTCTAATGCCCCTTTTGGG + Intergenic
1053485422 9:38450605-38450627 GGAGTACTCATACTCCTGAAAGG - Intergenic
1197987109 X:132278445-132278467 GTAGTGCTGATGTTCCTTTAAGG + Intergenic
1201144529 Y:11056705-11056727 GGGGTACTAATGCTGCCTTCCGG - Intergenic