ID: 903077886

View in Genome Browser
Species Human (GRCh38)
Location 1:20786583-20786605
Sequence CGTCGCCGGGGCGGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 525}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903077886_903077895 4 Left 903077886 1:20786583-20786605 CCGCGGCGCCCGCCCCGGCGACG 0: 1
1: 0
2: 4
3: 74
4: 525
Right 903077895 1:20786610-20786632 CAGCGGCGGAACGCGAGCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 63
903077886_903077893 -10 Left 903077886 1:20786583-20786605 CCGCGGCGCCCGCCCCGGCGACG 0: 1
1: 0
2: 4
3: 74
4: 525
Right 903077893 1:20786596-20786618 CCCGGCGACGGAAGCAGCGGCGG 0: 1
1: 0
2: 1
3: 17
4: 209
903077886_903077898 27 Left 903077886 1:20786583-20786605 CCGCGGCGCCCGCCCCGGCGACG 0: 1
1: 0
2: 4
3: 74
4: 525
Right 903077898 1:20786633-20786655 CGCTCCGCACACTCACCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
903077886_903077897 26 Left 903077886 1:20786583-20786605 CCGCGGCGCCCGCCCCGGCGACG 0: 1
1: 0
2: 4
3: 74
4: 525
Right 903077897 1:20786632-20786654 GCGCTCCGCACACTCACCACTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903077886 Original CRISPR CGTCGCCGGGGCGGGCGCCG CGG (reversed) Intronic
900349740 1:2228680-2228702 CGCCGCCGGGGCGCGCGGGGCGG + Exonic
900629328 1:3625287-3625309 CAGGGCCGGGGCGGGGGCCGAGG + Intronic
901077165 1:6562453-6562475 CGTGGCCTGGGCAGGCGCGGTGG - Intronic
901088339 1:6625443-6625465 CATCCCCGCGGCGGGCGCGGCGG - Intronic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901577166 1:10210457-10210479 CGTGTCCGTCGCGGGCGCCGGGG + Intergenic
901836363 1:11926334-11926356 GGGGGCCGGGGTGGGCGCCGCGG - Exonic
902067468 1:13700214-13700236 CGGCGCGGCCGCGGGCGCCGGGG + Intronic
902429559 1:16352488-16352510 ATGCGCCGGGGCGGGCGCGGCGG + Intergenic
902586219 1:17439876-17439898 CGGAGCCGAGGCGGGCGGCGAGG - Intergenic
902620278 1:17646787-17646809 CCTCGCCGGGACGGGCCCAGAGG - Intronic
903077886 1:20786583-20786605 CGTCGCCGGGGCGGGCGCCGCGG - Intronic
903446269 1:23424522-23424544 CCTCCCGGGGGCGGGGGCCGTGG + Intronic
904141676 1:28358357-28358379 CGTCTCTGGGCCGGGCGCAGTGG - Intergenic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904500125 1:30908532-30908554 CGCCCACGGGGCCGGCGCCGGGG - Exonic
905717096 1:40161429-40161451 TGTCGCCGGGGCTGGGGCTGAGG + Exonic
905863895 1:41366520-41366542 TGTGGCGGGGGCGGCCGCCGTGG - Intronic
905912253 1:41662707-41662729 CGGAGCCGGGGCGGGCGCGGAGG - Intronic
906680986 1:47725353-47725375 GGTGCCCCGGGCGGGCGCCGCGG - Intergenic
907040090 1:51251340-51251362 CGTAGACGGGGCCGGGGCCGAGG - Intronic
907223893 1:52927361-52927383 CGGGACCGGGGCGGGCGCCGCGG - Exonic
907429880 1:54405782-54405804 CGAGGCCGCGGCGGGCGGCGTGG - Intronic
907513788 1:54980766-54980788 AGCCCTCGGGGCGGGCGCCGGGG + Intergenic
911144804 1:94541823-94541845 AGCGGCGGGGGCGGGCGCCGGGG - Intergenic
911176125 1:94820260-94820282 AGTCGCCGGGCCAGGCGCAGAGG + Intergenic
913518988 1:119628055-119628077 CGTTGGCGGGGCGGGGGGCGGGG + Intronic
914758464 1:150579772-150579794 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914758468 1:150579778-150579800 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914869123 1:151458819-151458841 GCGCGCCGCGGCGGGCGCCGGGG + Intronic
914993095 1:152515460-152515482 GGGCGCCGGGGTGGGCGCCGGGG - Exonic
915247663 1:154567979-154568001 CGCCGCCGGGGGGAGGGCCGCGG - Exonic
916890253 1:169106606-169106628 CGGCGGCGGGGCGGGGGCGGAGG - Exonic
920882096 1:209889421-209889443 CGTGGCCAGAGTGGGCGCCGAGG + Intergenic
921024043 1:211260540-211260562 CGGCGCCGGGGCGAGCGAGGTGG - Intronic
922116382 1:222618052-222618074 GGAGGCCGGGGCGGGCGCAGAGG - Intergenic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
923372632 1:233328241-233328263 CGCCGCCGTGTCGGGCGACGAGG + Exonic
924524734 1:244835767-244835789 GGTCGGCGGGGCGCGCGCCGCGG + Intronic
1065025240 10:21534554-21534576 GGGCGCCGGGGCGGGCTCGGGGG + Intronic
1065177742 10:23095590-23095612 CGGCGCCGGAGCGGGCGTCATGG + Exonic
1065696919 10:28388544-28388566 CCTCCCCGGGCCGGGCGCGGTGG - Intergenic
1065712616 10:28532679-28532701 CAGCGCAGGGGCGGGGGCCGCGG + Intronic
1067445100 10:46337038-46337060 CCTAGCCGGGGCCGGGGCCGGGG + Intergenic
1067445104 10:46337044-46337066 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067497689 10:46774648-46774670 CTTCGGCCGGGCGGGCGCCCCGG - Intergenic
1067497816 10:46775082-46775104 GGTGGCCGTGGGGGGCGCCGGGG + Intergenic
1067502315 10:46816330-46816352 CCTAGCCGGGGCCGGGGCCGGGG + Intergenic
1067502319 10:46816336-46816358 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067592268 10:47523684-47523706 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1067592272 10:47523690-47523712 CCTAGCCGGGGCCGGGGCCGGGG - Intronic
1067596833 10:47565332-47565354 GGTGGCCGTGGGGGGCGCCGGGG - Intergenic
1067596960 10:47565766-47565788 CTTCGGCCGGGCGGGCGCCCCGG + Intergenic
1067639388 10:48031763-48031785 CCTAGCCGGGGCCGGGGCCGGGG - Intergenic
1067830792 10:49610176-49610198 CGTCGGCGGGGCGGGGGCCGGGG - Intronic
1069695524 10:70382687-70382709 CGGCGCCAGGACCGGCGCCGCGG + Intergenic
1070136377 10:73697913-73697935 CCTAGCCGGGGCCGGGGCCGGGG - Exonic
1070570736 10:77637995-77638017 CGGAGCCGGGGCGGGCCCGGGGG - Intronic
1070877291 10:79826087-79826109 TCTCGCCGGGGCGGGCGGCGGGG - Intergenic
1071309463 10:84328841-84328863 CGGGGTCGCGGCGGGCGCCGGGG + Intronic
1071643788 10:87342131-87342153 TCTCGCCGGGGCGGGCGGCGGGG - Intergenic
1072110285 10:92313315-92313337 TGTGGCCGGGCCGGGCGCGGTGG + Intronic
1072336704 10:94403620-94403642 CGGGGCCGGGGCCGGAGCCGGGG + Intronic
1072491188 10:95907606-95907628 CGTCCCCGGGGAGGACGCTGCGG - Intronic
1073325690 10:102643143-102643165 CGTCGCCTGGGCAGCAGCCGGGG + Intergenic
1074056055 10:109923569-109923591 CGTGGCGGGCGCTGGCGCCGCGG + Intergenic
1074843146 10:117374955-117374977 CGTCGGCGGGGCGGGGGTCTCGG + Exonic
1075131293 10:119742109-119742131 TGTCGTCGGGCCGGGCGCAGTGG - Intronic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1076821548 10:132942363-132942385 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1076821567 10:132942398-132942420 CCTCCCCGGGGCGGGGGTCGTGG + Intronic
1076857586 10:133124830-133124852 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076857590 10:133124836-133124858 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076916011 10:133423459-133423481 TGCCGCCGGGGCGGCAGCCGGGG - Exonic
1077018478 11:407186-407208 CGGCGCAGGGGCGGGGGCGGGGG + Intronic
1077121500 11:910938-910960 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077121504 11:910944-910966 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077249939 11:1556653-1556675 CGTCTCCGGGGCCGGCTCCTCGG + Exonic
1077249970 11:1556751-1556773 CTTCGGCCGGGCGGGCGCCCCGG - Exonic
1077253777 11:1571861-1571883 CGGGGCGGGGGCGGGCGCCGGGG - Intronic
1077253833 11:1571995-1572017 CGCAGCCGGGGCAGGGGCCGGGG + Intergenic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077495495 11:2884866-2884888 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495503 11:2884878-2884900 CGGGGCCGGGGCTGGGGCCGGGG + Exonic
1077495526 11:2884932-2884954 CGGAGCCGGGGCCGGGGCCGGGG + Exonic
1078514101 11:12008502-12008524 CGCCGTCGGAGCGGGCGCGGGGG + Exonic
1079163170 11:18012969-18012991 CGCCGCGGGGGCGGCCTCCGAGG + Exonic
1079451199 11:20601247-20601269 CGGCGGCGGGGCGGCAGCCGCGG - Exonic
1080606640 11:33869634-33869656 CGCGGCCGAGGCGGGGGCCGGGG + Intronic
1080802136 11:35618775-35618797 CCGCTCCGGGCCGGGCGCCGTGG - Exonic
1081636782 11:44727061-44727083 CGGGGCCGGGGCTGGGGCCGGGG - Intronic
1081636790 11:44727073-44727095 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636794 11:44727079-44727101 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636798 11:44727085-44727107 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081832016 11:46121773-46121795 CGTCGGCGGGGGGGGCGACGGGG + Intergenic
1081863618 11:46347831-46347853 CGGCGGCGGGGCAGGCACCGAGG + Intronic
1081873274 11:46392584-46392606 GGTCGCCGGGGCCGGAGCCCGGG + Intergenic
1083258288 11:61509731-61509753 GGGCGCCGGGGCGGAGGCCGGGG - Exonic
1083618114 11:64036218-64036240 AGCCGACGGGGCGGGGGCCGGGG + Intronic
1084284068 11:68120695-68120717 CGGGGCCGGGGCGGAGGCCGGGG - Intronic
1084295929 11:68213436-68213458 GGGCGCGGGGGCGGGCGCCGGGG - Intronic
1084516072 11:69638552-69638574 GGTCACCGGGGCGGGGGCCAGGG + Intergenic
1085561028 11:77473425-77473447 CGTTGCGGGGCCGGGCGCCTGGG - Intronic
1087188777 11:95231042-95231064 CGTCGCTGGGGCAGCTGCCGCGG - Exonic
1088679447 11:112226579-112226601 CGTCACCGGGGCGGGGCCGGCGG + Intronic
1088764704 11:112963414-112963436 CGTCGCCGGGGAGGGCATCCTGG + Intronic
1089208923 11:116787919-116787941 CGGGGCCGGGGCGGGCGACGGGG + Exonic
1089496519 11:118910943-118910965 CGCCGCCGGAGCGGGAGGCGCGG + Intronic
1089729635 11:120512037-120512059 GGGCGCGGGGGCGGGGGCCGGGG - Intronic
1091740749 12:2959232-2959254 CCGGGCCGGGGCGGGCGGCGGGG - Intergenic
1092159847 12:6310383-6310405 CGCCGCCGGGGGAGGCGGCGAGG - Intergenic
1092256240 12:6928073-6928095 CGCGGCGGGGGCGGGCGGCGCGG + Intronic
1093464843 12:19439371-19439393 AGGCGCCGGGGCGGGGGCGGGGG + Intronic
1093711475 12:22334244-22334266 CGTCCCAGGGGCGGGGGCCGGGG + Exonic
1095432024 12:42144677-42144699 GTTCGTCGGGGCGGGCGCGGCGG - Exonic
1096716206 12:53493039-53493061 CGTGGCTGGGGCGGGGGCCGCGG + Intronic
1096796749 12:54082581-54082603 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796753 12:54082587-54082609 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1097267545 12:57755038-57755060 GGCGGGCGGGGCGGGCGCCGGGG - Intronic
1100315623 12:93441988-93442010 CGTCGCCGCAGCCGCCGCCGAGG + Exonic
1100611418 12:96194407-96194429 CGCGGCCGGGGCGCGCGGCGCGG + Exonic
1100830798 12:98515436-98515458 AGGCGCTGGGGCGGGAGCCGAGG - Intergenic
1103085794 12:118061122-118061144 CCTGGCCGGGGCGGGCGGCGCGG - Intronic
1103107854 12:118246201-118246223 CGTGGACGGGGCCGGGGCCGAGG + Intronic
1103856008 12:123972226-123972248 CCCCGCGGGGGCGGGCGCGGGGG + Intronic
1104901095 12:132189887-132189909 CGAGGCCGGGGGAGGCGCCGGGG - Intergenic
1105004324 12:132711333-132711355 CATCGCCGGAGCGCGGGCCGGGG + Intronic
1105472088 13:20703777-20703799 CGGCGCCGGGCTGGGCCCCGGGG + Intronic
1105502883 13:20988337-20988359 CGCAGCCGGGGCGGGGGCGGGGG + Exonic
1106162229 13:27212043-27212065 CGTGGCCAGAGCGGACGCCGAGG - Intergenic
1107605097 13:42048824-42048846 GGCCGCCGGAGCCGGCGCCGCGG + Exonic
1108686670 13:52826152-52826174 CGTGGCCAGAGCGGACGCCGAGG - Intergenic
1110436293 13:75481467-75481489 CGTCCCCGCGCCGGGCGCTGGGG - Exonic
1110705979 13:78602272-78602294 CATGGCCGGCGCGGGCGGCGCGG - Exonic
1112507230 13:99982307-99982329 CGGAGCCGGGGTAGGCGCCGGGG - Exonic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1113120244 13:106917584-106917606 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120248 13:106917590-106917612 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120252 13:106917596-106917618 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120256 13:106917602-106917624 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120260 13:106917608-106917630 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120264 13:106917614-106917636 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113493996 13:110713864-110713886 AGGCGGCGGGGCTGGCGCCGGGG - Intronic
1113962324 13:114132774-114132796 CGGGGCGGGGGCGGGGGCCGAGG - Intergenic
1115320744 14:32077124-32077146 CGGCGCGGCGGCGGGCGCTGGGG + Intronic
1115399247 14:32939152-32939174 GGTGGCCGGGGCCGGGGCCGTGG - Intronic
1117131952 14:52695673-52695695 GGCTGCCGGCGCGGGCGCCGCGG - Exonic
1117315155 14:54566185-54566207 TGCCGTCGGGGCGGGCGGCGCGG - Intergenic
1119219364 14:72893587-72893609 CAGCGGCGGGGCGGGGGCCGCGG + Intronic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119742896 14:77026011-77026033 CGGCGCCGGGGCACGCGGCGGGG - Exonic
1119787078 14:77321594-77321616 AGTCCCCGGGCCGGGCGCGGTGG + Intronic
1121101539 14:91253483-91253505 CGTGGCGGGGGCGGGAGACGCGG - Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1121764039 14:96470103-96470125 CCTCTCCCGGGCGGGCGCGGTGG - Intronic
1122399542 14:101458704-101458726 CGAGGCCGCGGGGGGCGCCGCGG - Intergenic
1122418364 14:101560936-101560958 CCTCGGTGGGGCGGGAGCCGGGG + Intergenic
1122947847 14:105021301-105021323 CGTGGCGGGGCCGGGCGCAGGGG - Intergenic
1122975188 14:105168151-105168173 GGTCGGCGGGCCGGGCGCCAGGG + Intronic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1123630737 15:22258194-22258216 CGCGGGCCGGGCGGGCGCCGGGG - Intergenic
1124142289 15:27088251-27088273 GGGCGCGGGGGCGGGCGCGGGGG + Intronic
1124207846 15:27738446-27738468 CAACGCCGGGCCGGGCGCGGTGG + Intergenic
1124500440 15:30223293-30223315 CGGCCCCGGCGCGGGCCCCGAGG - Intergenic
1124500448 15:30223302-30223324 CCGCGCCGGGGCCGGGGCCGGGG + Intergenic
1124743126 15:32315365-32315387 CCGCGCCGGGGCCGGGGCCGGGG - Intergenic
1124957226 15:34367319-34367341 GGGCGCCGCGGCGGGCGCGGAGG - Intergenic
1125086376 15:35734890-35734912 AGTCACCGGGCCGGGCGCGGTGG - Intergenic
1125200735 15:37099011-37099033 CGCCGCCGGGGCCGCCGCTGGGG - Intronic
1125536115 15:40441762-40441784 CGCGGCCGGGGGCGGCGCCGCGG + Intronic
1125903641 15:43370976-43370998 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125903645 15:43370982-43371004 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1128099906 15:64989972-64989994 CGTCGCCGTGGCGACCGCCGGGG - Intronic
1128153548 15:65377862-65377884 CGGCGCCGGGGCCGGGGCTGGGG + Exonic
1128344132 15:66842828-66842850 CGGCGCCGGCGCGGGCGGGGAGG + Intergenic
1130296083 15:82647768-82647790 CGCAGCCGGGTCCGGCGCCGCGG - Intronic
1131005042 15:88971069-88971091 CGTGGCCAGAGCGGACGCCGAGG + Intergenic
1131831039 15:96354552-96354574 GGTCTCGGGGGAGGGCGCCGGGG + Intergenic
1132055777 15:98649379-98649401 CGCGGACGGGGCGGGCGGCGCGG - Exonic
1132055925 15:98649982-98650004 TGGTGCCGGGGCGGGCTCCGCGG + Intronic
1132464744 16:72367-72389 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132600013 16:769165-769187 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600041 16:769213-769235 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132683455 16:1153031-1153053 CGTGGCCGGGGCGGGGCCGGGGG - Intergenic
1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1132825716 16:1904231-1904253 CGTCCCCGGGACGGGGGCTGCGG + Intergenic
1132838023 16:1964486-1964508 CGTGGACGGGGCCGGGGCCGAGG - Exonic
1132842376 16:1984361-1984383 CGGCGCCTGGGCTGGCGTCGAGG - Exonic
1132893248 16:2214828-2214850 CGGGGGCGGGGAGGGCGCCGCGG - Intergenic
1133038215 16:3046396-3046418 GGACGCCCGGGCGGGGGCCGGGG - Intergenic
1133156604 16:3880555-3880577 GGCCGCCGGGGCGGGCGCCGAGG + Exonic
1133784432 16:8963600-8963622 CGCCGCCGGGGCCGGGGCCGGGG + Intronic
1134024192 16:10942058-10942080 CGGCGCCCGGGCGGCCGGCGAGG + Exonic
1134531999 16:14990257-14990279 GGGGGCCGGGGTGGGCGCCGCGG - Intronic
1136141640 16:28292540-28292562 CGCAGCCCGGGCGGGCGCCGGGG + Exonic
1136237828 16:28925338-28925360 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
1136365216 16:29806483-29806505 CGTCGCCGCCGCCGTCGCCGCGG + Intronic
1136428225 16:30183272-30183294 CCGGGCCGGGGCGGGCACCGAGG + Intronic
1136458431 16:30395426-30395448 CGTCCCGGGGGCGGCCACCGGGG - Exonic
1136778984 16:32885577-32885599 CGGCACCGGGGAGGGCCCCGAGG + Intergenic
1136891634 16:33975941-33975963 CGGCACCGGGGAGGGCCCCGAGG - Intergenic
1137559245 16:49492470-49492492 CGAGGCCGGGGCCGGGGCCGGGG + Intronic
1137559249 16:49492476-49492498 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1137655323 16:50153839-50153861 CGGGGCCGGGGCCGGGGCCGAGG - Exonic
1137665277 16:50246049-50246071 GGGCGCGGGGGCGGGAGCCGGGG - Intergenic
1139051415 16:63129513-63129535 CGTGGCCAGAGTGGGCGCCGAGG - Intergenic
1139534413 16:67562686-67562708 CGGCGGCGGAGCGGGCGCCGCGG + Exonic
1140458011 16:75115767-75115789 TGTCAGCGGGGCGGGCGCAGGGG - Intronic
1141185178 16:81781873-81781895 CGTCTCGGGGGCGGGCGGGGGGG - Intronic
1141972308 16:87492379-87492401 CGCGGGCCGGGCGGGCGCCGGGG + Intergenic
1141998051 16:87647564-87647586 CTTCGCCCGAGCGGGCGTCGCGG + Intronic
1142403498 16:89873441-89873463 CGGCGTCTGGGCGGGCTCCGGGG - Intergenic
1203081395 16_KI270728v1_random:1147666-1147688 CGGCACCGGGGAGGGCCCCGAGG + Intergenic
1142631689 17:1229784-1229806 CGCGGCGGGGGCGGGCGCCCCGG + Intergenic
1142876250 17:2853529-2853551 CGGGGCCGGGGAGGGCGCCTGGG + Intronic
1143321401 17:6070971-6070993 CGTCACCCGGGAGGGCGCTGCGG + Intronic
1143492892 17:7294362-7294384 AGGCGGCGGGGCGGGCGGCGGGG - Exonic
1143540105 17:7563533-7563555 CGCCACCGGGGCCGGCGGCGGGG + Exonic
1144519790 17:15945845-15945867 CGGCGCCCGGGGAGGCGCCGTGG + Intronic
1144586805 17:16492120-16492142 CGTCGCGGGGGCGGGCGGGCGGG + Intronic
1144775304 17:17782154-17782176 CCGCGCAGGGGCGGGGGCCGCGG + Intronic
1145214763 17:21043080-21043102 TGTCGCGGGGCGGGGCGCCGCGG + Intronic
1145828244 17:27893338-27893360 CGTCGCCGCGGCGGCGTCCGGGG - Exonic
1147139720 17:38454151-38454173 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1147629012 17:41918331-41918353 CGCCTCCGGGGCGGGCCACGCGG - Intronic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1148323703 17:46771701-46771723 CGGCGCCGGGGCCGGGGGCGCGG - Intronic
1148445264 17:47733596-47733618 CGTCGCGGGGGCGGCAGCCTGGG + Exonic
1148929969 17:51120324-51120346 CGGCGGCAGGGCGGGGGCCGCGG - Intronic
1150791884 17:68205742-68205764 CGGGGCCGGGGCAGGGGCCGGGG - Intergenic
1151812554 17:76453034-76453056 CGGCGCCGGGACGGGGGCTGCGG + Exonic
1152543987 17:80991805-80991827 CCGCGCCGGGCCAGGCGCCGCGG - Intronic
1152544067 17:80992027-80992049 CGGGGCCGGGGCGGGCGGCGGGG + Intronic
1152617974 17:81346428-81346450 CGTCGCCGGCGGGTGCGCCCAGG + Intergenic
1152629471 17:81403847-81403869 CTTCGGCGGGGCGGGCGTGGCGG - Intronic
1152714382 17:81891477-81891499 GGCGGCCGGGGCGGGGGCCGGGG - Exonic
1152718501 17:81911237-81911259 CGGGGCCGGGGCGGGCCGCGGGG - Intronic
1152770850 17:82167901-82167923 CGTTGACAGGCCGGGCGCCGTGG - Intronic
1153688259 18:7567441-7567463 CGTGGCCGTGGCGGTGGCCGTGG - Exonic
1153815281 18:8785444-8785466 CGCCGCTGGGGAGGGCGCGGAGG + Intronic
1155877038 18:31101394-31101416 CGTGGCCTGGGCAGGCGCTGAGG + Intronic
1157279154 18:46334389-46334411 CGGGGCGGGGGCGGGCGCCGCGG + Intronic
1157384226 18:47248070-47248092 GGGCGCGGGGGCGGGTGCCGGGG - Intronic
1157833628 18:50879238-50879260 CATCGCCAGGGCGGGCGGCAGGG + Exonic
1157867329 18:51197633-51197655 CGCCGCCGCCGCGCGCGCCGGGG - Intronic
1158137612 18:54224276-54224298 CGGGGCCGGGGCCGGGGCCGCGG - Exonic
1158137632 18:54224312-54224334 CGTGGCCGGGGCCGGGGCCGTGG - Exonic
1158190965 18:54828434-54828456 CGCCGCCGCGGCGGACTCCGAGG + Exonic
1158649415 18:59272934-59272956 GGGCGCCGGGGCTGGCGGCGGGG + Exonic
1158954367 18:62524407-62524429 CGAGGCCGGGGAGGCCGCCGGGG - Intronic
1159770503 18:72542197-72542219 CGGCGCCGGCGCGAGCGGCGCGG + Exonic
1160163213 18:76491274-76491296 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160454843 18:78992950-78992972 TGGCGCCGGGGCGGGGGCAGCGG - Exonic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160675863 19:390942-390964 GGGGGCCGGGGCGGGGGCCGGGG - Intergenic
1160714983 19:572500-572522 CGGGGGCGGGGCGAGCGCCGGGG - Intronic
1160719293 19:590337-590359 CGGCCCCGGCGCGGGCCCCGAGG - Exonic
1160724850 19:613560-613582 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160725016 19:614033-614055 CGTGGCCGGGGCGGGTGCCCTGG + Intronic
1160781298 19:878918-878940 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781302 19:878924-878946 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160831982 19:1108456-1108478 CGACGCCGGGGCCGGCGTCCAGG + Exonic
1160858714 19:1228716-1228738 GCTCGCCCGGGCGGGGGCCGCGG - Exonic
1160948071 19:1652527-1652549 CGACGCGGCGGCGGGCACCGCGG - Intronic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1161013645 19:1972054-1972076 CGTCACCAGGCCGGGCGCAGTGG - Intronic
1161115541 19:2494802-2494824 CGTTCCCGGGGCTGGCGCGGAGG + Intergenic
1161438728 19:4279100-4279122 AGTCGCCGGGGCCGAGGCCGCGG - Exonic
1161505082 19:4639512-4639534 CGGAGCCGGGGCCGGGGCCGGGG - Intronic
1161924944 19:7293531-7293553 CCGCGGCGGGGCGGGCACCGGGG + Intronic
1162914210 19:13865553-13865575 CAGCCCCGGGGCGGGCGCCCCGG + Intronic
1163027043 19:14518474-14518496 CGCCGCGGGGGCGGGCGGGGCGG - Intronic
1163243303 19:16077031-16077053 CGACTCCGGGGCTGGCGCCGGGG + Intronic
1163426862 19:17245079-17245101 CGACGCCGAGCCGGGCGACGAGG - Exonic
1163442620 19:17329360-17329382 CCTCGCCGGGGTGGGCAGCGTGG - Intronic
1163547231 19:17947801-17947823 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1163708633 19:18832398-18832420 CGGCGCGGGCGCGGGCGCTGCGG + Exonic
1165349740 19:35269195-35269217 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1165939169 19:39406775-39406797 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1166754034 19:45179592-45179614 GCGCGCGGGGGCGGGCGCCGGGG - Exonic
1166832203 19:45645476-45645498 CGGCGCCGGGCCCGGCGCTGGGG + Exonic
1166852841 19:45768673-45768695 CGGGGCCGGGGCGGGCGCAGCGG - Exonic
1166882946 19:45940222-45940244 CGGGGCCGGGGCGGGCGGCGGGG - Exonic
1167369738 19:49073317-49073339 CGACTCCAGGCCGGGCGCCGTGG - Intergenic
1167376416 19:49114555-49114577 GGTGGGCGGGGCGGGCGCCGGGG + Intronic
1167466136 19:49651888-49651910 CGGGGCGGGCGCGGGCGCCGGGG - Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167596799 19:50432323-50432345 CGCCTCCGGGGAGGGCGCCGCGG - Intergenic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1167921463 19:52786341-52786363 CCTCCCCGGGGCTGGGGCCGGGG + Intronic
1168076399 19:53982764-53982786 GGTCCCGGGGGCGGGCGCAGAGG - Exonic
1168307314 19:55442647-55442669 CGCGGGCGGGGCGGGCGCGGCGG - Exonic
1168332790 19:55579572-55579594 CGTGGCCGAGGCCGGGGCCGTGG - Exonic
1168339437 19:55614902-55614924 CCACGCGGGGGCGGGCGCCGGGG + Exonic
924962323 2:46134-46156 CGGGGCCGGGGCGCGGGCCGGGG + Exonic
925912702 2:8583758-8583780 AGGCGCCGGCGCGGGCGGCGAGG - Intergenic
928278014 2:29920339-29920361 GGTTGCTGGGGCCGGCGCCGGGG - Exonic
928518323 2:32064130-32064152 CGGCGCCGGGGCCGAGGCCGAGG - Exonic
929646736 2:43636275-43636297 CGTCTCTGGGCCGGGCGCAGTGG - Intergenic
930096445 2:47570294-47570316 CTACGGCGGGGCGGGGGCCGGGG + Exonic
932156142 2:69419209-69419231 GGTGGCGGGGGGGGGCGCCGAGG + Intronic
934588587 2:95526930-95526952 CGTCCGCGGGGCGGGGGCGGCGG - Intergenic
934933145 2:98444917-98444939 TGCCGCCGGGTCGGGCTCCGTGG + Exonic
934933217 2:98445121-98445143 CGCCGCGGGGGCCGGGGCCGGGG + Intronic
934978594 2:98822800-98822822 CGGGCTCGGGGCGGGCGCCGTGG + Exonic
935237501 2:101151097-101151119 GCTCGCCGGGGCGGGCGCGGCGG - Intronic
936141786 2:109947592-109947614 CGACGGCGGGGCGGGCTCCCAGG - Intergenic
936178474 2:110245540-110245562 CGACGGCGGGGCGGGCTCCCAGG - Intergenic
936202904 2:110423892-110423914 CGACGGCGGGGCGGGCTCCCAGG + Exonic
936433258 2:112482217-112482239 GGTAGCCGGCGCGGGCGGCGGGG + Exonic
937221602 2:120345660-120345682 CGGCGCTGCGGCGGGCGCTGCGG - Intergenic
937283397 2:120735735-120735757 CGCCGCCGGGGCGGGGGGAGGGG - Intronic
938018297 2:127885699-127885721 TCTCGCCGGGGCGGGCGGCGGGG - Intronic
938795847 2:134718231-134718253 CTTCGCCGGGGCGGGCAGCCGGG + Intronic
939969660 2:148644962-148644984 CGGCGGCGGGGCGGGCGGGGAGG - Exonic
941666356 2:168247283-168247305 TGCCGCCGGGGCCGGGGCCGGGG + Exonic
941666361 2:168247289-168247311 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
941666363 2:168247295-168247317 CGGGGCCGGGGCCGGGGCCGCGG + Exonic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
944221655 2:197310207-197310229 CGCCGCCGGCCCGGGCCCCGGGG - Intronic
944495855 2:200306844-200306866 GGTCGCCAGGGGAGGCGCCGCGG - Intronic
945673737 2:212832015-212832037 CGGCGCCGGGGCTTGGGCCGAGG - Intergenic
946019859 2:216633613-216633635 CGGCGGCGGGGCGCGCGCGGAGG + Exonic
946339597 2:219059121-219059143 CCGGGCCGGGCCGGGCGCCGAGG - Intronic
946692424 2:222319514-222319536 CGGGGCCGGGGTGGGCGGCGGGG + Intergenic
947353658 2:229271382-229271404 CATGCCCGGGGCGGGCGCCCAGG + Intergenic
947523357 2:230864841-230864863 CGCAGGCGCGGCGGGCGCCGGGG + Intronic
947800870 2:232928005-232928027 CGGCGGCGGGGCGGGTGCGGGGG + Intronic
948479158 2:238239635-238239657 CGGCGGCCGGGCAGGCGCCGTGG - Intronic
948645158 2:239400216-239400238 CGTCGCCGCTGCGAGCGCCCGGG - Intronic
948697313 2:239738209-239738231 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697317 2:239738215-239738237 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948801503 2:240435522-240435544 CGGCGCGGGGGCGCGGGCCGGGG - Intergenic
948824854 2:240569116-240569138 TGAGTCCGGGGCGGGCGCCGGGG + Intronic
948991675 2:241558860-241558882 CGTGGACGGGGCGGGCGCCGGGG + Exonic
949004266 2:241636758-241636780 CGTCTCTGGGCCGGGCGCCTCGG - Intronic
1168795882 20:610033-610055 CGGCGGCGGCGCGGGCCCCGTGG - Exonic
1168804451 20:664215-664237 CGGCGGCGGGGCGGGGGCGGCGG - Exonic
1168913242 20:1466767-1466789 CGTGGCGGTGACGGGCGCCGAGG - Exonic
1169118605 20:3082740-3082762 GGTCGCTGGCGCGGGCGCGGCGG + Exonic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1172028971 20:31968298-31968320 GGTCGTCGGGGCGGGCGGCCCGG + Exonic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172596570 20:36154625-36154647 CGAGGCCGGGGCGGGGGCGGGGG + Intronic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173279714 20:41617932-41617954 CCCCCCCGGGGCGGGCGCGGTGG - Intronic
1173488409 20:43458266-43458288 CGTCGCGGGGGCGCGCGGTGGGG + Intronic
1174386600 20:50191293-50191315 CGTGGCCGTGGCGGGCGCCGGGG - Exonic
1174402379 20:50282967-50282989 CGTGGCCGAAGCGGGGGCCGTGG - Intergenic
1175877831 20:62238737-62238759 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1176005579 20:62860957-62860979 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1176005749 20:62861586-62861608 CGTCGAGGGCGCGGGCGGCGGGG - Exonic
1176084914 20:63291461-63291483 CGTCGCCGTGGCGGGCTCCCAGG - Intergenic
1176194590 20:63831341-63831363 CGGCGGCCGGGCGCGCGCCGGGG - Intergenic
1176197452 20:63844044-63844066 GGACGGTGGGGCGGGCGCCGAGG + Intergenic
1176286806 21:5022838-5022860 AGGCGCCGGGGCGGCCGGCGGGG + Intronic
1176546837 21:8205889-8205911 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1176547856 21:8209172-8209194 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176554742 21:8250098-8250120 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1176555747 21:8253374-8253396 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1176556315 21:8255978-8256000 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176565788 21:8388936-8388958 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1176566793 21:8392206-8392228 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176573663 21:8433123-8433145 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1176574684 21:8436408-8436430 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1176575254 21:8439020-8439042 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176611298 21:8987701-8987723 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178610431 21:34074147-34074169 CGGCGGCGGGGCCGGCGACGAGG - Intronic
1179502556 21:41819455-41819477 TGTGGCGGGGGCGGGGGCCGGGG - Intronic
1179605611 21:42513728-42513750 CGGGGCCGGGGCCGGAGCCGGGG + Intronic
1179870375 21:44240637-44240659 AGGCGCCGGGGCGGCCGGCGGGG - Intronic
1179909132 21:44438729-44438751 CGACGCGGGGGCAGGCGCCAGGG + Intronic
1180005520 21:45018907-45018929 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1180955823 22:19740799-19740821 CAAGGCCCGGGCGGGCGCCGAGG - Intergenic
1181171843 22:21014379-21014401 GGTTGCCGGGGCGACCGCCGCGG - Intronic
1181177448 22:21045803-21045825 GGTTGCCGGGGCGACCGCCGCGG + Intergenic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1183370147 22:37427521-37427543 CCTCGGCGGGGAGGGCGCCCGGG + Intergenic
1183391926 22:37550257-37550279 AGTGGCTGGGCCGGGCGCCGTGG + Intergenic
1183393721 22:37560348-37560370 CGGTGCCGGGGAGGGGGCCGGGG + Intergenic
1183517133 22:38273040-38273062 CGCCGCCGGGGAGGGCGGGGCGG + Intergenic
1183607057 22:38872066-38872088 CGCAGCCGGGGCCGGGGCCGGGG - Intronic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1184439083 22:44497921-44497943 CGGGCGCGGGGCGGGCGCCGCGG - Intronic
1184673417 22:46027601-46027623 CGTCCCGGGCGCGGGCGGCGAGG - Intergenic
1184853062 22:47131850-47131872 CTTGGACGGGGCGGGCGCCCCGG - Intronic
1185335857 22:50270545-50270567 CCTTCCCGGGGGGGGCGCCGAGG + Intronic
1185398444 22:50604198-50604220 CGGCTCCGAGGCGGGCGACGAGG - Exonic
1185409455 22:50674479-50674501 CGGGGCCGGGGCCGGCGCGGGGG - Intergenic
1185409537 22:50674647-50674669 CGGCCCCGGGGCCAGCGCCGTGG + Intergenic
1203251712 22_KI270733v1_random:122174-122196 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1203252732 22_KI270733v1_random:125459-125481 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1203253305 22_KI270733v1_random:128075-128097 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203259762 22_KI270733v1_random:167256-167278 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1203260788 22_KI270733v1_random:170545-170567 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1203261360 22_KI270733v1_random:173154-173176 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
949552405 3:5122257-5122279 CGGCGCCGGGACGGGCGTGGGGG + Exonic
950420979 3:12899345-12899367 CTCCGCCTGGGCAGGCGCCGGGG + Exonic
953397119 3:42582070-42582092 CTTCGCCGGGACGGGGGCTGTGG - Intronic
953680666 3:45035923-45035945 AGCCGGCGGGGCGGGGGCCGTGG + Exonic
953748699 3:45594042-45594064 CGGCGCGCGGGCGGGCGCCCAGG - Intronic
954277965 3:49554680-49554702 CTGCGCCGGGGCCGGGGCCGGGG - Exonic
954795939 3:53161402-53161424 CGTTGCAGGGGCAGGCGCCAAGG - Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
958641535 3:96813499-96813521 CGGCCCTGGGGCGGGGGCCGCGG + Intergenic
958814521 3:98901388-98901410 CGTCTCCTGGTCGGGTGCCGCGG - Exonic
958977289 3:100682422-100682444 CGTCGGCGGGTTGGGCGCGGTGG - Intronic
959085747 3:101849437-101849459 AATGGCCGGGCCGGGCGCCGGGG + Intronic
960914364 3:122681188-122681210 GGTGGCCGGGGCGGGGGCGGGGG + Intronic
961320101 3:126067097-126067119 GGTGGCCGGGGCGGGGGGCGGGG - Intronic
961446304 3:126983259-126983281 CGGCGGCGGGGCGCGCCCCGGGG + Intergenic
963253258 3:143120698-143120720 CGACTCCGAGGCGGGCGCGGCGG - Exonic
963904469 3:150762691-150762713 CGCCGCCGCGGCGGGCACCGCGG + Exonic
964041633 3:152268638-152268660 CGGAGCCCGCGCGGGCGCCGTGG - Exonic
966808658 3:183825272-183825294 CGCCGCCGGGGCGCGGACCGGGG - Exonic
966886425 3:184380118-184380140 CGGCGCCGGGCCGGGCGGGGCGG - Exonic
966886445 3:184380177-184380199 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968341576 3:197960186-197960208 CGGGGCCGGCGCGGGCGCAGAGG + Intronic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968603351 4:1520658-1520680 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603370 4:1520699-1520721 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603409 4:1520781-1520803 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603468 4:1520904-1520926 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603487 4:1520945-1520967 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603525 4:1521027-1521049 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603544 4:1521068-1521090 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603563 4:1521109-1521131 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603582 4:1521150-1521172 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968603601 4:1521191-1521213 CGTCCCCGGGGCGGCCTCGGAGG - Intergenic
968616682 4:1580647-1580669 CGTGGCCTGGGCGGGAGGCGGGG - Intergenic
968659699 4:1793915-1793937 CATGGCGGGGGCGGGGGCCGCGG - Exonic
968750605 4:2387058-2387080 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
968907980 4:3463334-3463356 GGGCGCCGGGGCGAGCGCGGCGG + Exonic
969525044 4:7700050-7700072 CGTGGCTGGGGCGGGAGCCCTGG - Intronic
970202852 4:13627440-13627462 CGGCGCGGGTGCGGGCGCCGGGG - Exonic
970202858 4:13627455-13627477 CGCGGGCGGGGCGGGCGGCGCGG - Exonic
971256759 4:25021642-25021664 AGTCGCCTGGCCGGGCGCGGTGG + Intronic
976199015 4:82561547-82561569 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
978621356 4:110637179-110637201 CAGCGCCCGGGCGAGCGCCGGGG + Intronic
980035782 4:127881256-127881278 CGGCTGCGGGGCGGGCACCGAGG + Intronic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
985068352 4:186144723-186144745 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985068389 4:186144822-186144844 CGGCGCCGGCGCGGGCGGGGCGG + Exonic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985713864 5:1445265-1445287 GGGCGCAGGGGCGGGGGCCGGGG - Intronic
986733188 5:10649815-10649837 CTTCCGCGGGGCGGGCGCTGCGG - Exonic
987193192 5:15500226-15500248 CTTCCCCGGGGAGGGCGCGGCGG - Exonic
990376196 5:55173295-55173317 CGGGGCCGCGGCGCGCGCCGGGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991505363 5:67318742-67318764 CGTGGCCAGAGCAGGCGCCGAGG - Intergenic
992105747 5:73448075-73448097 CGCCGCCGGGGCCGGGCCCGGGG + Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
996405348 5:123098378-123098400 GGTCGCGCCGGCGGGCGCCGAGG + Intronic
997297547 5:132777331-132777353 CGTGGCCGGGCCGGGCGGGGAGG - Exonic
997470625 5:134115116-134115138 GGTCCCGGGGGCCGGCGCCGGGG + Exonic
997470630 5:134115128-134115150 CGGCGCCGGGGCCCGCGGCGAGG + Exonic
999419050 5:151425256-151425278 CGGCGCGGGGCGGGGCGCCGGGG - Intergenic
999696218 5:154190598-154190620 CGACGCGGGGGCAGGCGGCGCGG + Intronic
1001035171 5:168292055-168292077 CTTAGCCCGGGCGGCCGCCGAGG - Intronic
1002170336 5:177371074-177371096 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170340 5:177371080-177371102 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170344 5:177371086-177371108 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170348 5:177371092-177371114 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170352 5:177371098-177371120 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002487734 5:179550928-179550950 GGCCGCCGGCGCGGGCGCGGTGG + Intronic
1002505914 5:179679022-179679044 CGGCGCAGTGGCGGCCGCCGTGG + Exonic
1002548223 5:179966908-179966930 TGTCGCCGGCGAGGTCGCCGAGG + Exonic
1002580857 5:180208889-180208911 CGGCGCGGGAGCGTGCGCCGGGG - Intronic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1003569469 6:7246746-7246768 CGACGGCGAGGCAGGCGCCGGGG + Exonic
1003942603 6:11044121-11044143 GGGCGCCGGCGCGGGCGCTGCGG - Intronic
1004354011 6:14915869-14915891 CGCCGCCAGAGTGGGCGCCGAGG - Intergenic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1004663242 6:17728639-17728661 CGTGGCCAGAGTGGGCGCCGAGG - Intergenic
1004722182 6:18277347-18277369 GGCCGCCGGGGCGAGGGCCGAGG + Intergenic
1006304127 6:33208659-33208681 CGGCGCGGGGGCGGGAGCGGGGG + Intronic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006472715 6:34237478-34237500 CGGCGCGGGGGCGGGCGGCGGGG + Intronic
1006932827 6:37697795-37697817 CGGGGCCGGGCCGGGCTCCGGGG + Exonic
1007591154 6:43021672-43021694 CCGCGCCGGGGCCGGGGCCGGGG + Exonic
1007591158 6:43021678-43021700 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1009615556 6:65999842-65999864 CGTGGCCAGAGTGGGCGCCGAGG + Intergenic
1012875462 6:104720924-104720946 CGTCGCTGGGCCGGGCGCGGTGG - Intergenic
1013349184 6:109290533-109290555 CGTCGCTGGGGCAGGGGCAGGGG - Intergenic
1013372671 6:109483549-109483571 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1013556321 6:111260196-111260218 GCTTGCCGGGCCGGGCGCCGTGG - Intronic
1014272267 6:119348780-119348802 CGGGCCCGGGGCGCGCGCCGAGG - Exonic
1015149311 6:130020111-130020133 CGGGGCCGGGGCCGGCGCCGGGG + Intronic
1015999642 6:139029472-139029494 CGGCGCCGGGCCGGGAGCTGCGG + Intronic
1016340931 6:143060843-143060865 GCGCGCGGGGGCGGGCGCCGTGG - Intronic
1016386757 6:143537070-143537092 CGCCGGCGGGGCGGGCGCCTCGG - Intronic
1016590162 6:145735348-145735370 CGGCACCGCGGCGGGCGACGGGG - Exonic
1016965873 6:149718132-149718154 CGTCGCTTGCGCGGGGGCCGAGG + Exonic
1017725638 6:157274579-157274601 CGTGGGCGGGACGGGCTCCGTGG + Intergenic
1018400255 6:163414421-163414443 CCCCGGCGGGGCGGGCGACGGGG - Intronic
1018613024 6:165662091-165662113 CGCCGCCTGGGCCGGCGCCGGGG + Intronic
1019379230 7:712518-712540 CGGCGCGGGGGCGGGCGTGGAGG - Intronic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1021685503 7:23181984-23182006 AGTAGCCCGGCCGGGCGCCGAGG + Exonic
1022103810 7:27184608-27184630 CGCCGCCGCGGAGGTCGCCGTGG + Exonic
1022375554 7:29807572-29807594 TGTGCCCGTGGCGGGCGCCGGGG + Intronic
1022427952 7:30285546-30285568 CGGCGCCGCGGCGGCCGCGGCGG + Exonic
1022942532 7:35254198-35254220 CGCCGCCGGGGGCGGGGCCGCGG + Intergenic
1027233031 7:76282893-76282915 GGCCGACGGGGCGGGCGGCGGGG + Intronic
1029238760 7:99143870-99143892 CGGCTCCGGGCTGGGCGCCGGGG + Exonic
1031919133 7:127588594-127588616 CTGCGCCGGGGCCGGCGCCCCGG - Intronic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1032160041 7:129502853-129502875 CGGGGCCAGGGCGCGCGCCGTGG + Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034278956 7:149838529-149838551 GGTCCCCGGGGCGGTCGCGGCGG + Exonic
1034781839 7:153888129-153888151 CGAGGCCGGCGCGGGCGCCAGGG - Intronic
1036454063 8:8892932-8892954 CGCCGCCGGGGCCTGCCCCGGGG - Exonic
1037495655 8:19438179-19438201 CTTGGCCGGGGCGGGGGTCGGGG + Intronic
1038575562 8:28701332-28701354 GGGCGCGGGGCCGGGCGCCGGGG - Exonic
1038808003 8:30812489-30812511 CGGCGCCCGGGCCGGGGCCGGGG - Exonic
1039557209 8:38485104-38485126 AGCCTCCAGGGCGGGCGCCGTGG + Intergenic
1039903153 8:41767268-41767290 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1041449945 8:57995120-57995142 CGGGGCCGGGGCTGGAGCCGGGG + Intronic
1041686714 8:60651858-60651880 CTTCCCCGGGCCGGGCGCCGTGG - Intergenic
1042611695 8:70607877-70607899 CATCTCCGGGCCGGCCGCCGGGG + Intronic
1043148338 8:76682476-76682498 CGGCGCGGGCGCGGGCGCCGCGG + Intronic
1043502821 8:80873883-80873905 GCTCTCCGGGGCGGGCGCCGGGG + Intronic
1047961712 8:130016210-130016232 GGCCGCCGGGCCGGGCGCTGCGG - Intronic
1048112790 8:131486925-131486947 CGTGGCCAGAGTGGGCGCCGAGG - Intergenic
1049194679 8:141308605-141308627 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049508996 8:143018469-143018491 CGGCCCCGGGGCGGGGGCAGGGG - Intronic
1049665447 8:143840808-143840830 CGGCCCCGGAGCCGGCGCCGAGG - Exonic
1049827221 8:144676851-144676873 CGTGGCCAGAGCGGACGCCGAGG + Intergenic
1051459500 9:17295310-17295332 CGCCGCCAGAGTGGGCGCCGAGG + Intronic
1052358523 9:27529470-27529492 TCTCGCCCGGGCGGGCGGCGAGG - Intronic
1052362234 9:27573502-27573524 CGTGGTCGGGGCGGGCCCGGGGG - Intronic
1053163489 9:35829322-35829344 CGGGCCCGGGGCGGGGGCCGGGG - Intronic
1053393324 9:37751757-37751779 CGTGGCCAGAGCGGGCGCCAAGG - Intronic
1055785201 9:79863729-79863751 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1056170687 9:83981132-83981154 TTGCGCCGGGGCGGGAGCCGGGG + Intronic
1057337308 9:94166206-94166228 CGATGCAGGGGCGGGCGCCGCGG - Intergenic
1057478702 9:95426979-95427001 CGGAGCCGGGGCAGGAGCCGGGG - Intergenic
1057596443 9:96418869-96418891 CGAGGGCGGGGCGGGCGGCGGGG - Intergenic
1060849196 9:126860686-126860708 CGGCGGCGGAGGGGGCGCCGCGG + Intronic
1061275895 9:129569211-129569233 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061275899 9:129569217-129569239 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061293708 9:129666157-129666179 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293712 9:129666163-129666185 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061347942 9:130042454-130042476 GGCGGCCGGGGCGAGCGCCGGGG - Intronic
1061457986 9:130712988-130713010 CGTCGCCGTGGGCGGGGCCGAGG + Intergenic
1061559649 9:131394270-131394292 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061900900 9:133671489-133671511 CGGGGCGGGGGCGGGCGCAGTGG - Intronic
1062389344 9:136327775-136327797 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1062421072 9:136483052-136483074 CGTCGGCGGCGCGGCGGCCGCGG - Intronic
1062574607 9:137200367-137200389 GGCCCCCGGGGCGGGCGGCGCGG + Exonic
1062594940 9:137295395-137295417 GGGAGGCGGGGCGGGCGCCGGGG - Intergenic
1203468114 Un_GL000220v1:105325-105347 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1203469135 Un_GL000220v1:108610-108632 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1203469705 Un_GL000220v1:111222-111244 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203475935 Un_GL000220v1:149297-149319 CGTCGCCTGGGCCGGCGGCGTGG + Intergenic
1203476956 Un_GL000220v1:152582-152604 TGTCCCCGGGCCGGGCACCGCGG + Intergenic
1203477526 Un_GL000220v1:155194-155216 CGTCGTCGGGGCCGCGGCCGGGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1185447613 X:267800-267822 CGTCGCCGGGCCGGGCGTGGTGG - Intergenic
1186466239 X:9786354-9786376 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186466243 X:9786360-9786382 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186768147 X:12791766-12791788 CTTCGCAGGCGCGGGCGCGGGGG - Intronic
1187507294 X:19887807-19887829 CCGCGTCGGGGCAGGCGCCGGGG + Intergenic
1189429717 X:40935724-40935746 CGTGGACGGGGCCGGGGCCGAGG - Intergenic
1189821585 X:44873797-44873819 CGGCGGCGGGGCGGGCACCTCGG + Intronic
1189988553 X:46574461-46574483 CGTGTCCGGGGCGCGCGCAGCGG - Exonic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1190385634 X:49879960-49879982 CCGCGCCGGGGCCGGGGCCGGGG - Exonic
1190783993 X:53625858-53625880 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1192152003 X:68718365-68718387 CGGGGCCGGGGCTGGGGCCGGGG - Exonic
1192216333 X:69161948-69161970 CAGTGCCGGGGCTGGCGCCGGGG - Exonic
1195156123 X:102125925-102125947 AGTCGCGGGGGCGGGGGCAGTGG + Intronic
1196860935 X:120026267-120026289 CGTGGCCAGAGTGGGCGCCGAGG + Intergenic
1197754304 X:129983707-129983729 GGCCGCCGGGCCGGGCGCGGCGG + Intronic
1199944064 X:152651696-152651718 TGTCGCCTAGGCTGGCGCCGAGG - Exonic
1200100821 X:153688477-153688499 CGGCACCGGGGAGGGCCCCGAGG - Exonic
1200123704 X:153803397-153803419 CATCGGCGGAGCGCGCGCCGTGG + Exonic
1200209649 X:154341591-154341613 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209653 X:154341597-154341619 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209657 X:154341603-154341625 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200221195 X:154390489-154390511 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221199 X:154390495-154390517 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221203 X:154390501-154390523 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221207 X:154390507-154390529 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221211 X:154390513-154390535 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221215 X:154390519-154390541 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221219 X:154390525-154390547 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221223 X:154390531-154390553 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221227 X:154390537-154390559 CGGGGCCGGGGCCGGGGCCGGGG - Intronic