ID: 903078104

View in Genome Browser
Species Human (GRCh38)
Location 1:20787330-20787352
Sequence GGCCCCGCGCGCGCCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903078087_903078104 21 Left 903078087 1:20787286-20787308 CCAGTCCCAGCCGCCGAGCTCTG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078097_903078104 -10 Left 903078097 1:20787317-20787339 CCCCCCTACCCGCGGCCCCGCGC 0: 1
1: 0
2: 5
3: 52
4: 490
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078096_903078104 -7 Left 903078096 1:20787314-20787336 CCGCCCCCCTACCCGCGGCCCCG 0: 1
1: 0
2: 8
3: 98
4: 1091
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078090_903078104 11 Left 903078090 1:20787296-20787318 CCGCCGAGCTCTGCCGCCCCGCC 0: 1
1: 0
2: 4
3: 37
4: 308
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078095_903078104 -6 Left 903078095 1:20787313-20787335 CCCGCCCCCCTACCCGCGGCCCC 0: 1
1: 0
2: 12
3: 101
4: 1108
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078091_903078104 8 Left 903078091 1:20787299-20787321 CCGAGCTCTGCCGCCCCGCCCCC 0: 1
1: 0
2: 6
3: 103
4: 791
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078092_903078104 -2 Left 903078092 1:20787309-20787331 CCGCCCCGCCCCCCTACCCGCGG 0: 1
1: 0
2: 11
3: 93
4: 904
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078086_903078104 24 Left 903078086 1:20787283-20787305 CCTCCAGTCCCAGCCGCCGAGCT 0: 1
1: 0
2: 0
3: 21
4: 313
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078088_903078104 16 Left 903078088 1:20787291-20787313 CCCAGCCGCCGAGCTCTGCCGCC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078089_903078104 15 Left 903078089 1:20787292-20787314 CCAGCCGCCGAGCTCTGCCGCCC 0: 1
1: 0
2: 1
3: 28
4: 264
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data
903078094_903078104 -5 Left 903078094 1:20787312-20787334 CCCCGCCCCCCTACCCGCGGCCC 0: 1
1: 0
2: 8
3: 99
4: 1004
Right 903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903078104 Original CRISPR GGCCCCGCGCGCGCCCCCGC CGG Intergenic