ID: 903087680

View in Genome Browser
Species Human (GRCh38)
Location 1:20877520-20877542
Sequence GCACCTACTAAGTTGCAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903087680 Original CRISPR GCACCTACTAAGTTGCAATA TGG (reversed) Intronic
903087680 1:20877520-20877542 GCACCTACTAAGTTGCAATATGG - Intronic
903481124 1:23654155-23654177 CCACCTACTAAGTTGCAGGGAGG - Intergenic
911558378 1:99374269-99374291 GCACCTAAAAAGTCACAATAAGG + Intergenic
919971718 1:202584737-202584759 GCACCTCCAAAGGTGCAAAAAGG + Exonic
920283207 1:204859502-204859524 GCACCCACTATGTGGCACTAAGG - Intronic
921319800 1:213927715-213927737 GCCCCTTCTAAATTGCCATATGG + Intergenic
1063817170 10:9788615-9788637 GCACCTGCTAAGTTGTGAGAAGG - Intergenic
1065109689 10:22427515-22427537 GCACCTACTAATGTCCAATGAGG + Intronic
1068019254 10:51560446-51560468 AATCCTACTAAGTTGCAAGAGGG - Intronic
1073476571 10:103757531-103757553 GCACATACCAAGTTGTAACAAGG + Intronic
1075078639 10:119368345-119368367 GCACCTGCGACGTGGCAATACGG - Intronic
1087075146 11:94121572-94121594 GCACCTCCTCAGTTGTAATTGGG + Intergenic
1092470846 12:8779262-8779284 TCACCTAATAAGTTTGAATATGG - Intronic
1098739757 12:74157665-74157687 TCACCTTCTCAGTAGCAATAAGG - Intergenic
1113264116 13:108597953-108597975 GCAACTTCTCACTTGCAATAAGG - Intronic
1117212797 14:53518766-53518788 TCACCTAGTAAGTTACAATGTGG - Intergenic
1128476174 15:67998576-67998598 GTACCTACTAAGTTCAAATTTGG + Intergenic
1130214116 15:81952574-81952596 GCACCCACCAAGATCCAATAGGG + Intergenic
1135350172 16:21722562-21722584 GCACCTACTTTGTTTTAATAAGG - Intronic
1137468148 16:48729898-48729920 GCACCTCTGAAGTTGCAATCTGG - Intergenic
1139182809 16:64767801-64767823 GCAAATACTAAATTGCAACAAGG - Intergenic
1145804257 17:27715174-27715196 CCACCTCCTCAGTTGCAATTGGG + Intergenic
1146550794 17:33778866-33778888 GCCCCTACTGGGTAGCAATAGGG + Intronic
1149856966 17:60091205-60091227 GCAGCTACTAAGTTGGAGTCAGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1154326403 18:13394005-13394027 ACACCTACTAAATTGCAAGTAGG - Intronic
1157122257 18:44922361-44922383 GCACCTGCAAAATTGCAAAACGG + Intronic
1157475567 18:48021379-48021401 GCACCTACTGAGTGGCAGGAAGG + Intergenic
925928402 2:8686153-8686175 GCAACTACTAATTTGCAAAAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
930583277 2:53238596-53238618 ACACCTAATAAATTACAATATGG + Intergenic
932765617 2:74467671-74467693 GCACATACTGGGTTGCACTATGG - Intergenic
935616655 2:105091303-105091325 GCACCTACAAAGGGGCACTATGG - Intronic
937035619 2:118779239-118779261 GGCTCTACTCAGTTGCAATAGGG + Intergenic
938617936 2:133019156-133019178 TAACTTACTAAGTTGCTATACGG + Intronic
941417564 2:165241000-165241022 TCACGTACTAAATTACAATAAGG + Intronic
941928611 2:170919430-170919452 GCACCTGCAAAGTTGCTAGAAGG + Intergenic
1184846829 22:47093051-47093073 GCTGCCACTAAGTTGCAAGAAGG - Intronic
951148440 3:19257625-19257647 GCACCTACTAATATGCAAATAGG - Intronic
952573746 3:34748697-34748719 GCACCTAGAAAGTTGCAGCAAGG + Intergenic
959184697 3:103031732-103031754 GCACCTACTATGATGTAACAGGG - Intergenic
967583801 3:191189146-191189168 CCACCTCCTCAGTTGCAATTGGG + Intergenic
977092793 4:92700587-92700609 GCACCTACTAGGTACAAATATGG + Intronic
996486060 5:124035881-124035903 CCACTTAATAAGTTTCAATATGG + Intergenic
1004987809 6:21102482-21102504 GGGCTTACTAAGATGCAATAAGG - Intronic
1017316630 6:153038459-153038481 TCACTTACAAAGTAGCAATACGG - Intronic
1017966541 6:159271482-159271504 CCACCAACTAAGTCGCACTAGGG + Exonic
1018480635 6:164186028-164186050 GCACCGACTAAGCTAAAATACGG + Intergenic
1020791128 7:12629592-12629614 GGAACTGCAAAGTTGCAATATGG + Intronic
1030836682 7:114295838-114295860 GCAGCTAAAAAGTTGGAATAAGG - Intronic
1031731904 7:125311215-125311237 CCACCTTCTCAGTTGCAATTGGG + Intergenic
1032174602 7:129612470-129612492 CCACCTCCTAACTTGCAAGAAGG - Intronic
1033525354 7:142208049-142208071 GTACCTAGTTAGTGGCAATAAGG - Intronic
1042616342 8:70654091-70654113 GCACTTACTAAGTTGTATTGTGG - Intronic
1045845940 8:106636381-106636403 CCACTTAATAAGTTGCAAAAGGG - Intronic
1047267534 8:123321196-123321218 GCAAATAGTAAGTTTCAATATGG + Intronic
1048080983 8:131126751-131126773 GCACACACTAAGGTGGAATAAGG - Intergenic
1048192369 8:132301550-132301572 CCATCTACTAAGTGGCAACAAGG + Intronic
1048361283 8:133699123-133699145 CTACCAATTAAGTTGCAATATGG - Intergenic
1051713748 9:19959922-19959944 ACACCTAGTAAGTTGGGATAAGG + Intergenic
1051748430 9:20317549-20317571 TCACCTACTAAGTGGAAATGAGG + Intergenic
1052351334 9:27461337-27461359 GCACCTACTAAGTAGGCATAAGG - Intronic
1053305523 9:36981906-36981928 GCACCTCCTAAGAGTCAATAAGG + Intronic
1189780507 X:44509682-44509704 GCATCTACTAAATGACAATATGG + Intergenic
1199112627 X:143953428-143953450 GTATCTACAAAATTGCAATATGG + Intergenic