ID: 903088275

View in Genome Browser
Species Human (GRCh38)
Location 1:20883664-20883686
Sequence AATAAAGGACAGAAAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903088269_903088275 25 Left 903088269 1:20883616-20883638 CCATCTTAAAAGAAAAAAAAAAA 0: 20
1: 2888
2: 91688
3: 70322
4: 103534
Right 903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG 0: 1
1: 0
2: 3
3: 45
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903088275 Original CRISPR AATAAAGGACAGAAAGAGCT AGG Intronic
900211496 1:1458433-1458455 AAAAAAAGACAAAATGAGCTGGG - Intronic
901528310 1:9837905-9837927 AAGAAAGGAAAGAAAGAGGAAGG + Intergenic
901963173 1:12843648-12843670 TATAAAAGACAGATATAGCTTGG + Intergenic
901990367 1:13107971-13107993 TATAAAAGACAGATATAGCTCGG + Intergenic
902301011 1:15502783-15502805 AATGAAAGACAGAAAGGGCAGGG - Intronic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
903964502 1:27078564-27078586 AAAAAAAGAAAGAAAGGGCTGGG - Intergenic
904103783 1:28058778-28058800 AAATCAGGACAGAAAGAGCAGGG - Intronic
904219152 1:28950825-28950847 AAAAAAGTACAGAAACTGCTAGG - Intronic
904441138 1:30532573-30532595 AATAAATGAAACCAAGAGCTGGG - Intergenic
904940343 1:34161759-34161781 ACTAAAAGACAAAAAGAGATGGG + Intronic
905177033 1:36143210-36143232 AATAAAGCACAAAAACAGATTGG + Intronic
905475910 1:38227921-38227943 AATAGAGGAAAGAAACAGCAGGG - Intergenic
906442391 1:45859887-45859909 TAAAAAGAACAGAAAGAGCAGGG - Intronic
906494486 1:46294401-46294423 AAAAAAAGAAAGAAAGGGCTGGG - Intronic
906964673 1:50444600-50444622 AATAAAGAACAGAGAGAGGAGGG - Intronic
907085934 1:51674031-51674053 AACAAAGGAAAGAAAGAGAGAGG - Intronic
907949211 1:59164746-59164768 AATAAGGCAAAGAAAGAGTTGGG - Intergenic
908057886 1:60311314-60311336 AATAAGAGATAGAAAAAGCTTGG + Intergenic
908061251 1:60352037-60352059 AAGAAAGAACAGAGAGAGATGGG + Intergenic
908232266 1:62117400-62117422 AATAAAGGAGAGAAAAATCTAGG - Intronic
908826460 1:68137264-68137286 ACTAAAGGACAGGAAGAACTGGG + Intronic
910538741 1:88330689-88330711 AATAAAGGACAGTAGTAGCAAGG + Intergenic
910746235 1:90577855-90577877 AGTAACAGACAGAAAGAGTTTGG + Intergenic
910990326 1:93049350-93049372 AATAAAGGTCAGAACCAGCCTGG + Intergenic
911160546 1:94678883-94678905 AATTAAGGACAGAGAGTTCTGGG + Intergenic
911428983 1:97758997-97759019 AATAAAGTACACAAAGTGTTGGG + Intronic
911500233 1:98677275-98677297 AATAAAAGAAAGAAAAAGATGGG - Intronic
911519860 1:98916352-98916374 AGTAAGGGACAGTAAGGGCTTGG + Intronic
911553275 1:99310721-99310743 TATAAAAGACAGAAATAGCAGGG - Intergenic
911752695 1:101516132-101516154 AATAAAAGTAAGAAAGGGCTAGG + Intergenic
912090716 1:106071901-106071923 TTTATAGAACAGAAAGAGCTAGG - Intergenic
912375085 1:109203369-109203391 ACTTAAGGGCAGAAACAGCTGGG + Intronic
912656437 1:111490116-111490138 ACTGAAGGTCAGACAGAGCTGGG + Intronic
913017384 1:114752811-114752833 AACAAAGTACAGAAATTGCTTGG - Intronic
913270912 1:117092698-117092720 AAAAAAGGACAGGAGCAGCTGGG - Intronic
913422319 1:118684913-118684935 ATTAAGGGACAGAATCAGCTTGG + Intergenic
913510857 1:119560555-119560577 AAAAAAGGACAGCAACACCTGGG + Intergenic
913515080 1:119597960-119597982 AAAAAAGGACAGTAACACCTGGG + Intergenic
914768522 1:150661664-150661686 AATGAGGGACAGAAAAAGCATGG - Intronic
914768562 1:150662214-150662236 AATAAAGGTAGGAAACAGCTGGG + Intronic
916194622 1:162211659-162211681 AAACAAGGAAAGAAAGAGTTCGG - Intronic
916623251 1:166524951-166524973 AAATGAGGAGAGAAAGAGCTGGG + Intergenic
917641541 1:176987702-176987724 AAGAAAAGAAAGAAAGAGCCTGG - Intronic
918993168 1:191724660-191724682 AATTAAAGACAGAAAGAAATAGG + Intergenic
919056939 1:192583010-192583032 AAGAAAAGACAGAAAGAGAGAGG + Intergenic
919189330 1:194195494-194195516 AAAAAATGACAGAGAAAGCTGGG - Intergenic
919237910 1:194870160-194870182 AAGAAAGGAGAGACAGAGATGGG + Intergenic
919249052 1:195029700-195029722 AAAAAAAGAAAGAAAGTGCTGGG + Intergenic
919360077 1:196581499-196581521 AATAAGGGACAGAAAAAAATGGG - Intronic
921557671 1:216618386-216618408 AATAAAGAACAGAATTAACTAGG + Intronic
922338189 1:224634668-224634690 AGAAAAGGAAAGGAAGAGCTAGG - Intronic
922528714 1:226326559-226326581 AATAAAGCAGAGAGACAGCTAGG - Intergenic
922707952 1:227800309-227800331 AATGAAAGATAGAAAGAGCAGGG - Intergenic
923788614 1:237092031-237092053 AATCAAGACCAGAGAGAGCTAGG - Intronic
923964548 1:239122803-239122825 AATAAAAGAAAAAAAGGGCTGGG + Intergenic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924194800 1:241594852-241594874 AATAAAAGACATAAAGCTCTGGG - Exonic
924290928 1:242535500-242535522 AATAAGGGACAGAGAGAGGAAGG + Intergenic
924583760 1:245344179-245344201 AGAAAAGGAAAGAAAGAGATAGG - Intronic
924843917 1:247746125-247746147 AGAAAAGGACAGAAAAAGTTTGG - Intergenic
924869541 1:248026505-248026527 ATTGAAGGACAGAAAGAAATGGG - Intronic
924871325 1:248048894-248048916 AGAAAAGGAAAGAAAAAGCTGGG - Intronic
1063019704 10:2115403-2115425 AATAAAGAAAAGAGAGAGATAGG - Intergenic
1063388068 10:5628927-5628949 AACAAAAGACAGAAAGAGACGGG - Intergenic
1063581218 10:7309439-7309461 GAGATAGGAAAGAAAGAGCTTGG - Intronic
1063677335 10:8153015-8153037 TATAAAGGAAAGAAAAACCTAGG + Intergenic
1063730073 10:8686660-8686682 AATAAAGTAGAAAATGAGCTGGG - Intergenic
1064199508 10:13272663-13272685 AATAACGGACAGGAAGAAATTGG - Intergenic
1064203049 10:13300244-13300266 AATAAAGGACGGAAGGATCATGG - Intronic
1064635390 10:17360571-17360593 AACAAAGGCCAGAAAGAGGTGGG + Intronic
1064734464 10:18366493-18366515 AATAAACCAAAGAAAGTGCTGGG - Intronic
1065302607 10:24336657-24336679 TATAAAGGATATAAAGACCTGGG + Intronic
1067110130 10:43394761-43394783 AGGTAAGGACAGAAACAGCTGGG + Intronic
1067141252 10:43659031-43659053 AATAAAGAATAGAAACAGGTGGG + Intergenic
1067141889 10:43664937-43664959 AATAAAGAATAGAAACAGGTGGG - Intergenic
1067516166 10:46946747-46946769 TACAAATGAAAGAAAGAGCTAGG + Intronic
1067646081 10:48105063-48105085 TACAAATGAAAGAAAGAGCTAGG - Intergenic
1067805463 10:49389375-49389397 AAAAAAGAACAGAAACAGCATGG + Intronic
1068642776 10:59428893-59428915 AATAAGGAAAAGAAAGAGCATGG + Intergenic
1068820260 10:61368178-61368200 AATAAATGACAAAAAAAGATTGG - Intergenic
1069028811 10:63573548-63573570 AACAAAGAACAGGAAAAGCTGGG + Intronic
1069905863 10:71731730-71731752 GAGATAGGACAGAAAGAGTTGGG - Intronic
1070910373 10:80112667-80112689 AATAAAGGATATAAACATCTAGG + Intergenic
1071180780 10:82981038-82981060 AAAAAAGGCCAGCATGAGCTGGG - Intronic
1071420704 10:85494507-85494529 AAGAAAGGAAAGAAAGAGGAAGG - Intergenic
1071681614 10:87711761-87711783 AATGAAGGACAGACAGAGGAAGG - Intronic
1071856420 10:89629724-89629746 AATAAAGTACAGAAATAAATGGG - Intronic
1071866440 10:89739079-89739101 AAGCAAGTACAGAAAGAGGTAGG + Exonic
1071974122 10:90938090-90938112 AACAGAGGACAGAGAAAGCTGGG + Intergenic
1072472752 10:95729183-95729205 ATTTAAGGACAGAAAGAGAAAGG - Intronic
1072762608 10:98069449-98069471 AATGAAGGTCTTAAAGAGCTAGG - Intergenic
1073015302 10:100394251-100394273 AAAACAGGACAGAAAAAACTTGG - Intergenic
1073296352 10:102441480-102441502 AAGAAAGAAAAGAAAGGGCTGGG + Intergenic
1073627102 10:105110394-105110416 AATAAAAGACAGAAAGGGACAGG - Intronic
1073733771 10:106322393-106322415 AATAAAGGATGGAATGAGATTGG + Intergenic
1074978333 10:118598870-118598892 AATAAAAGACAGAAAGATTATGG - Intergenic
1075027778 10:118999227-118999249 CTTAAAGGACTCAAAGAGCTGGG + Intergenic
1075534663 10:123260207-123260229 AAGAAAGGAAAGAAAGAGGGAGG + Intergenic
1075566776 10:123510774-123510796 AACATAGGACATAAAGAACTGGG - Intergenic
1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG + Intronic
1076075522 10:127530906-127530928 AAGAAAGGCCAGAAGCAGCTTGG - Intergenic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1076618478 10:131771937-131771959 AAGGAAGGACAGCAAGAGGTGGG + Intergenic
1077631574 11:3814712-3814734 AAAGAAGGAAAGAAAAAGCTTGG - Intronic
1079010657 11:16825563-16825585 AATAAAATACAGACAGTGCTTGG + Intronic
1079341703 11:19617051-19617073 AAAAAAGGAGAGAACAAGCTAGG - Intronic
1079975347 11:27084070-27084092 AAGAAAGGACAAAAAGACCCAGG + Intronic
1080038228 11:27731573-27731595 GACAGAAGACAGAAAGAGCTTGG - Intergenic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1080364972 11:31563438-31563460 CAGTAAGAACAGAAAGAGCTTGG + Intronic
1080411747 11:32031546-32031568 ATTAAATGACAGAAAGGTCTTGG - Intronic
1080540906 11:33263784-33263806 AACAAAAGACAGAAAGAGGAAGG - Intronic
1080612864 11:33919943-33919965 AGCAAAGGAAAGAAAGAGCTTGG + Intergenic
1081104848 11:39053665-39053687 AATAAGGGAAAGAAAGAGAGAGG - Intergenic
1081648505 11:44807060-44807082 AATAAAGGACAGTACAAGCCAGG + Intronic
1083861000 11:65419959-65419981 AAGAAAAGAAAGAAAGGGCTTGG + Intergenic
1084723181 11:70922781-70922803 AATAAAGAACAGGAAGATGTAGG + Intronic
1085473449 11:76773032-76773054 AACAGAGGACAGACAGAGCAGGG + Intergenic
1085602853 11:77870928-77870950 TATAAAGGAAAGAATGAGGTAGG - Intronic
1086400553 11:86458008-86458030 CAAGAAGGACAGAAAGAGTTAGG + Intronic
1086537506 11:87865787-87865809 AATATATGACAGAAAGAGGAAGG + Intergenic
1086596793 11:88582020-88582042 AAGGAAGGAAAGAAAGTGCTAGG - Intronic
1087154588 11:94888165-94888187 AAGAAAGGCTAGAAAGAGGTTGG - Intergenic
1087965265 11:104404923-104404945 ATTAAAGGTCACAAAGACCTTGG - Intergenic
1087975474 11:104540676-104540698 AATAAAGAACAAAAAGAGGAAGG + Intergenic
1088107009 11:106218728-106218750 ACTACAGGAAAGAAAGAGCCAGG - Intergenic
1088243530 11:107794403-107794425 GATAAAGCACAGAAAGAGAGTGG + Intronic
1088494459 11:110419324-110419346 GATAAAGGTCTGAAAGACCTGGG - Intergenic
1088676073 11:112194883-112194905 AATAAAGAGGAGAGAGAGCTGGG - Intronic
1089778104 11:120853268-120853290 AATACAGGACAGAAACCCCTTGG - Intronic
1090060075 11:123456942-123456964 AAGAAAAGAAAGAAAGAACTAGG + Intergenic
1091357998 11:134953023-134953045 AATGAAAGCCACAAAGAGCTGGG + Intergenic
1091889927 12:4045257-4045279 GACAAAGGACAGAGAGAGCCCGG - Intergenic
1092058841 12:5531490-5531512 AGAAAGGGACAGAAAGGGCTAGG - Intergenic
1092195529 12:6547685-6547707 AAGAAAGGACAGAAAGACAAGGG + Intronic
1093116135 12:15213449-15213471 AAGAAAAGATAGAAAGGGCTGGG + Intronic
1094180253 12:27584892-27584914 AATAAATGAATGAAAGAGCAGGG + Intronic
1094328322 12:29264654-29264676 AATAAAGGAGAGAGAGAGAGAGG + Intronic
1094603924 12:31934369-31934391 AAGAAAGGAAAGAAAGGGCCAGG + Intergenic
1094615133 12:32029573-32029595 AAGAAAGGAAAGAAAGAGGGAGG + Intergenic
1095751461 12:45716724-45716746 AGAAAAGGACAGAAAGGGCCAGG - Intergenic
1095768174 12:45920163-45920185 AATAAAGGTCAAAAACTGCTTGG + Exonic
1095790080 12:46157090-46157112 AATAAAGAATACAAAGAGCCAGG - Intergenic
1095805487 12:46314772-46314794 AAGAAAGAAAAGAAAGAGTTAGG - Intergenic
1095862252 12:46930567-46930589 AATAAAGGAGCTAAAGAACTTGG + Intergenic
1096118958 12:49074067-49074089 AATAAAGGAAAAATAGAACTTGG + Intergenic
1098175516 12:67786210-67786232 AAAAAAGGGTCGAAAGAGCTGGG + Intergenic
1098645417 12:72894723-72894745 AATATAGGTGAGAGAGAGCTTGG + Intergenic
1098787936 12:74782705-74782727 AACATATGACAGAGAGAGCTGGG - Intergenic
1099050208 12:77773039-77773061 CATAAATGACAGAAACAGATGGG + Intergenic
1099200650 12:79672857-79672879 AATATAGGACAGATAGTGGTGGG - Intronic
1100834041 12:98548783-98548805 AATATAGGGCAAAAAAAGCTCGG - Intronic
1100967353 12:100027286-100027308 GATGAAAGACAGAAAGAGCTAGG + Intergenic
1101039542 12:100740373-100740395 ATTAAAGGCCAGTGAGAGCTGGG - Intronic
1101386315 12:104261148-104261170 AAAAAAAGAAAGAAAGAGCAAGG - Intronic
1102516089 12:113447864-113447886 AATAGAAGACAGACAGAGCACGG + Intergenic
1103016003 12:117495025-117495047 AATAAAAGACATAGATAGCTGGG + Intronic
1103146501 12:118599620-118599642 TCCAAAGGACAGAAAGAGCCAGG - Intergenic
1103681937 12:122701091-122701113 AAACAAAGATAGAAAGAGCTGGG - Intergenic
1103683685 12:122714554-122714576 AAACAAAGATAGAAAGAGCTGGG - Intergenic
1104437321 12:128766401-128766423 AAAAACACACAGAAAGAGCTGGG + Intergenic
1106530873 13:30589987-30590009 AAGAAAGGAGAGAGAGAGGTGGG + Intronic
1106703557 13:32256064-32256086 AATAAAGGAAGGAAAAATCTGGG + Intronic
1107031968 13:35862401-35862423 AAGACAGAACCGAAAGAGCTGGG - Intronic
1107113290 13:36720757-36720779 AATAAAGGATTGAAAGAAATGGG + Intergenic
1107637953 13:42412047-42412069 AATAAAGTACGTAAGGAGCTAGG + Intergenic
1108064668 13:46564890-46564912 AATTAAGGACAGAAAGTGACAGG - Intronic
1108271299 13:48762264-48762286 AAGCAAAGATAGAAAGAGCTGGG - Intergenic
1108495586 13:51021529-51021551 AATAAAAGACAGTATGAGCAAGG - Intergenic
1109147679 13:58801753-58801775 AATAAAGGAGAGAAAGAGATAGG + Intergenic
1109517200 13:63459178-63459200 AGTAAAGGACAGAATGATCTTGG - Intergenic
1110182602 13:72635417-72635439 AAAAAAGGTCAGATAGAGCTTGG - Intergenic
1110345107 13:74438019-74438041 AAGAAAGGAAAGAAAGAGAGAGG + Intergenic
1110400271 13:75081643-75081665 AATAAAATAAAGAAAAAGCTGGG + Intergenic
1110484864 13:76026884-76026906 AATAAATGACTGAAACAGGTTGG - Intergenic
1111799789 13:92967539-92967561 AACAAAGGAATTAAAGAGCTGGG - Intergenic
1111835059 13:93377871-93377893 TACAAAGGACATAAAGAGGTAGG + Intronic
1112094198 13:96114443-96114465 AATAAAGAAAAGAAAGGGCCAGG - Intronic
1112671440 13:101643899-101643921 CAGAAAGAAGAGAAAGAGCTTGG - Intronic
1113045026 13:106146419-106146441 CAGAAAGAGCAGAAAGAGCTTGG - Intergenic
1113074234 13:106452144-106452166 AAAAAAGCACAGAGAGGGCTGGG - Intergenic
1113182861 13:107651240-107651262 AATACAGAACAGAAACAGCCCGG - Intronic
1113407868 13:110058267-110058289 AAAAAACGAGATAAAGAGCTTGG + Intergenic
1113468439 13:110528124-110528146 AATAAAGGAAAGAAAAAGGCCGG + Intronic
1113571401 13:111360926-111360948 AATAAAGGCCACCAGGAGCTGGG + Intergenic
1113888073 13:113671426-113671448 AATCATGGAAAGACAGAGCTGGG - Intronic
1115548211 14:34481955-34481977 AAAAAAGAACAGAATGAGTTGGG + Intergenic
1116101841 14:40448153-40448175 TAGGAGGGACAGAAAGAGCTAGG - Intergenic
1116243358 14:42376787-42376809 AAGAATGGACAGAAAGACCAAGG - Intergenic
1116353336 14:43895381-43895403 AGTACAGGACAGTAAGAGTTAGG + Intergenic
1116403394 14:44537697-44537719 AGTAATGTACATAAAGAGCTTGG + Intergenic
1116774971 14:49168416-49168438 AATAAAGAAAAGAAAAAGATAGG + Intergenic
1116963896 14:50994421-50994443 TAGAAAGGTCAGAAAGAGATTGG + Intronic
1116982107 14:51182691-51182713 AAAAAAGGAGGGAAAGAGGTAGG + Intergenic
1117343655 14:54812420-54812442 AGAAAAAGAGAGAAAGAGCTTGG - Intergenic
1117471600 14:56051584-56051606 ATTCAAAGACAGAATGAGCTTGG + Intergenic
1117555411 14:56878396-56878418 AATCCTGGCCAGAAAGAGCTGGG + Intergenic
1117650709 14:57902061-57902083 AGTAAAGGACAGAAAGGTGTTGG - Intronic
1117962747 14:61179074-61179096 AAGAAAGGACATTAAGAGGTGGG + Intergenic
1118694706 14:68373024-68373046 AGTAAGGGACAGAAAAAGCTGGG + Intronic
1118941448 14:70343253-70343275 AGTGAAGTACAGAAATAGCTTGG - Intronic
1120032121 14:79653834-79653856 AGTAAAGGACAGCAGAAGCTGGG + Intronic
1120255710 14:82116776-82116798 AATAAAGGACTGAAAAAGACTGG + Intergenic
1120427986 14:84375104-84375126 AATAAAGGACAGAAATTCCGTGG + Intergenic
1120572584 14:86140009-86140031 ATTAAAGTATAGAAAGAGCTTGG - Intergenic
1120834754 14:89029658-89029680 AATAAAGGAAATAATGAGCTTGG - Intergenic
1121278291 14:92682497-92682519 AAGAAAAGATGGAAAGAGCTGGG - Intronic
1122020486 14:98833913-98833935 ATGAGAGGACAGAAGGAGCTGGG + Intergenic
1123734957 15:23176106-23176128 AAAAAAATACAAAAAGAGCTGGG + Intergenic
1123848604 15:24329855-24329877 AATAAAGGGAAGAAAGAACAAGG - Intergenic
1124168004 15:27346092-27346114 AAGAAAGGAAAGAAAGAGAAAGG + Intronic
1124934360 15:34156297-34156319 GATATAGCAGAGAAAGAGCTTGG + Intronic
1125398611 15:39276317-39276339 AATAAAAGACAGATAGACTTTGG + Intergenic
1125551471 15:40548114-40548136 AATAAAGGAGAGATAGTGTTAGG - Intronic
1126418978 15:48451355-48451377 AATACAGGACAGGAAAAGCAGGG - Intronic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1127100021 15:55554487-55554509 AAAAAAAGAAAGAAAGAACTGGG + Intronic
1127906000 15:63376542-63376564 AAGAAAGGAAAGAAAGAGAGTGG - Intronic
1128045956 15:64617814-64617836 GATAAAGGACATAAAGTGTTGGG + Intronic
1128077993 15:64840486-64840508 AGGAAAGAAAAGAAAGAGCTGGG - Intergenic
1128460009 15:67859868-67859890 CTTAAAGGACAGGAAGAGCCAGG + Intergenic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1131129055 15:89883101-89883123 AATAAAGGATAGTTAGTGCTTGG - Intronic
1131479928 15:92772082-92772104 AAAAAAGGAAAAAAACAGCTGGG - Intronic
1131562742 15:93458584-93458606 AAACAAGGACAGAGAGAGCAAGG - Intergenic
1131873879 15:96784618-96784640 AAGAAAGGCCAGAGTGAGCTTGG - Intronic
1132920525 16:2387887-2387909 AAGAAAGAAAAGAAAGAGCCAGG + Intergenic
1133592978 16:7263973-7263995 AACAAAACACAGAAAGATCTTGG + Intronic
1133652113 16:7822327-7822349 AAGGAAGAGCAGAAAGAGCTGGG - Intergenic
1134389447 16:13805800-13805822 AATAAAGCAGAGAAAGAAATAGG - Intergenic
1134749448 16:16614261-16614283 AAAAAAGGAGAGAACTAGCTGGG - Intergenic
1134801373 16:17087690-17087712 AACATACGACAGAAAGAGCCTGG + Intergenic
1134996022 16:18739363-18739385 AAAAAAGGAGAGAACTAGCTGGG + Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135520937 16:23177621-23177643 AAAAAAAGAGAGAGAGAGCTAGG + Intergenic
1137259071 16:46807442-46807464 AAGAAAAGAAAGAAAGAGATTGG + Intronic
1137518919 16:49175053-49175075 AAAAAAGGAGAGAAAGAGGAAGG - Intergenic
1137518937 16:49175154-49175176 AAAAAAGGAGAGAAAGAGGAAGG - Intergenic
1137539529 16:49352720-49352742 AATGGGGGAGAGAAAGAGCTGGG + Intergenic
1137585320 16:49660802-49660824 AACAAAGGAGACACAGAGCTGGG + Intronic
1138011789 16:53388097-53388119 AATACAGGAGAGAAAGAACATGG - Intergenic
1138628942 16:58278213-58278235 AATAAAGGAGAGGAAGAGGAAGG + Intronic
1140680008 16:77375683-77375705 AATAAAGGACAGGAAAGGCCTGG + Intronic
1140855756 16:78976277-78976299 AATAAAGATCAGAAAGAAGTAGG - Intronic
1143148904 17:4794956-4794978 AAAAAAAGACAAATAGAGCTGGG + Intergenic
1143425963 17:6838096-6838118 AAGAAAAGAAAGAAAGAGCCAGG - Intergenic
1143544582 17:7588779-7588801 AGGAAAGGGCAGAATGAGCTCGG + Intronic
1143600427 17:7941969-7941991 AAAAAAAGACAGAAAGGGCCAGG + Intronic
1143962255 17:10730317-10730339 AAAGAAGGAAAGAAAGGGCTGGG + Intergenic
1144047054 17:11463540-11463562 AATAAAGGACAGCAAAATGTTGG - Intronic
1144415130 17:15039195-15039217 AAGGAAGGAGAGAAAGAGATGGG + Intergenic
1144427706 17:15159613-15159635 AACAAAGGAAAGCAAGAGGTGGG - Intergenic
1145215562 17:21049190-21049212 AAAAAAAAAAAGAAAGAGCTGGG + Intergenic
1145753259 17:27370331-27370353 CATAAAGGACAGACACAGCCAGG - Intergenic
1145766186 17:27459701-27459723 AATGAAGGCCAGAGTGAGCTGGG - Intronic
1146682558 17:34818548-34818570 AGTAAAGTACAGAAAGGGGTTGG - Intergenic
1147492187 17:40879987-40880009 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1147517372 17:41133689-41133711 AGTGAGGGACAGAAATAGCTGGG + Intergenic
1148389259 17:47258594-47258616 AAGAAGGGAAAAAAAGAGCTTGG - Intronic
1148861566 17:50607046-50607068 ATTCCAGGACAGAAAGAGCAAGG + Intronic
1149530577 17:57391727-57391749 AATAAACCTCAGAAAGAGGTGGG - Intronic
1149813858 17:59704417-59704439 CTTAAAGGACAGAAAGGTCTAGG + Intronic
1149930312 17:60746493-60746515 AATGAATGACTGAAAGTGCTTGG + Intronic
1150051938 17:61972788-61972810 AAAAAAGAACAGTAAGACCTTGG - Exonic
1150872677 17:68930917-68930939 AATAATTGACTGAAAGAGCATGG - Intronic
1151362893 17:73599234-73599256 AAGAAAGGAGAGAAGGTGCTGGG + Intronic
1151505119 17:74522404-74522426 ACCAAAGTACAGAAAGAGGTTGG - Exonic
1151761298 17:76104556-76104578 AAGAAAGGAAAAAAAAAGCTTGG - Intronic
1152493037 17:80650713-80650735 GATAAGGGACAGAAAGGGATGGG - Intronic
1155134021 18:22969529-22969551 AATAAAAGACAGAATTAGTTTGG - Intronic
1155275581 18:24184444-24184466 AATAAAGGGAAGAGAGAGCAGGG - Intronic
1155715951 18:28944017-28944039 AATATATGATAGAATGAGCTTGG + Intergenic
1155732228 18:29175023-29175045 TGTTAACGACAGAAAGAGCTTGG + Intergenic
1156170946 18:34484952-34484974 ACTGAAGATCAGAAAGAGCTAGG + Intergenic
1156257643 18:35412719-35412741 AAGAAAGGGCAGGAAGAGATGGG + Intergenic
1157014989 18:43701118-43701140 AAGGAAGGAGAGAAATAGCTTGG - Intergenic
1157440386 18:47707167-47707189 AATAAAGGCCAGGAAAGGCTGGG + Intergenic
1158430007 18:57376638-57376660 AGTAAAGGACATGAAGAGGTTGG - Intergenic
1159157498 18:64602846-64602868 ACTTGAGGACAGAAAGAGGTAGG + Intergenic
1160035427 18:75297150-75297172 AAAAAATCACAGAAAGAGCATGG + Intergenic
1160276065 18:77437459-77437481 ACTAAAAGACAGAAATTGCTGGG - Intergenic
1161052109 19:2169652-2169674 TTTAAAGGAAAAAAAGAGCTGGG - Intronic
1161999783 19:7736433-7736455 AAGGAAGGAAAGAAAGAGTTGGG - Intergenic
1162154946 19:8671315-8671337 AAGAAAACACAGTAAGAGCTGGG - Intergenic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
1162539057 19:11282742-11282764 AAAAAATTACAGAAAGGGCTGGG - Intergenic
1162928483 19:13943000-13943022 AAAAAAAGACAGAAAGGGCCAGG + Intronic
1163113463 19:15175661-15175683 AATAAAGCAGAGGAAGGGCTGGG + Intronic
1163452716 19:17388177-17388199 AAAAAAGGAAAAAAAGAGCCCGG - Intergenic
1163627370 19:18397857-18397879 AATAAATGACTGCATGAGCTGGG - Intergenic
1164014951 19:21246882-21246904 TATAAAGGACAGAAATGGGTGGG - Intronic
1164143345 19:22493801-22493823 AATAAAATACAAAAAAAGCTGGG - Intronic
1165975883 19:39676335-39676357 ACAAAAAGAAAGAAAGAGCTGGG + Intergenic
1166012809 19:39955915-39955937 AATAAAGAACAGTGTGAGCTGGG - Intergenic
1166041872 19:40208330-40208352 AAAAAAAGAAAGAAAGAGCCAGG - Intronic
1166328909 19:42067612-42067634 GACAAAGGACAGAAAGACCGAGG + Intronic
1166583730 19:43926835-43926857 AATAACAGGCAGAAAGAGATGGG + Intronic
1167129898 19:47578071-47578093 AAGAAAGGAAAGAAACAGATTGG + Intergenic
1168086538 19:54051756-54051778 AATAAAAGAAAGAAAGAATTTGG - Intronic
925297052 2:2784258-2784280 AATTGAGGACAGAAAGAGTATGG - Intergenic
926368786 2:12159654-12159676 AAGAAAGGAAAGAAGGAGGTAGG - Intergenic
926858435 2:17282348-17282370 CATAATGGGCTGAAAGAGCTAGG + Intergenic
927417106 2:22891085-22891107 AGTGAAGGACAGAAAGGGCCAGG - Intergenic
928064039 2:28145205-28145227 AAGCACAGACAGAAAGAGCTGGG + Intronic
928431772 2:31225868-31225890 AATAAAAGACAGAAAGGGAGAGG + Intronic
928755407 2:34518587-34518609 TATAAAGGACATGAAGAGCCAGG + Intergenic
929253011 2:39779675-39779697 AATGAAGGACAGGAAGAGGACGG - Intergenic
929859729 2:45666519-45666541 AAGAAGGGATAGAAAGAGTTTGG - Intronic
929924363 2:46196539-46196561 AATACAGGAGAGCCAGAGCTGGG + Intergenic
930165950 2:48204083-48204105 AAAAAAGGAAAAAAAGAGATGGG - Intergenic
930611679 2:53551609-53551631 AAGAAAGGAGAGAAAGAGAAAGG + Intronic
930740167 2:54824160-54824182 AACCAAGGACAGAAAGAGATAGG - Intronic
931448042 2:62343429-62343451 AATAAATGGCAGAAACAGCCTGG - Intergenic
931593745 2:63916572-63916594 AAGAAAAGATAGAAAGAGCCTGG + Intronic
931786807 2:65626914-65626936 AATGAAGAACAAAAAGAGATAGG + Intergenic
932106753 2:68950554-68950576 AATAATGGAAATAATGAGCTTGG - Intronic
932463486 2:71898266-71898288 AGTAATGGACAAAGAGAGCTGGG - Intergenic
932791480 2:74657607-74657629 AAGAAAGGCAAGAAAGAGGTAGG + Exonic
932818988 2:74883472-74883494 AGCAAGTGACAGAAAGAGCTGGG + Intronic
933119118 2:78514069-78514091 AATAAAAGACAGAAAGGGAGGGG - Intergenic
933450157 2:82438827-82438849 AATAAAGCAAAGTAAGAGGTAGG - Intergenic
933941588 2:87249510-87249532 AATGAAGGGCAGAGAGAGCCAGG + Intergenic
934169537 2:89328884-89328906 AATAAAGGAGAGAGAAAGTTTGG + Intergenic
934197755 2:89853701-89853723 AATAAAGGAGAGAGAAAGTTTGG - Intergenic
934877939 2:97943086-97943108 AAAGAAAGAAAGAAAGAGCTGGG + Intronic
935059002 2:99592215-99592237 AAGCAAGGACAGGGAGAGCTGGG - Intronic
936338636 2:111612081-111612103 AATGAAGGGCAGAGAGAGCCAGG - Intergenic
937395094 2:121528250-121528272 AATAAAGGACAGTAGAAGCTGGG + Intronic
937423198 2:121775434-121775456 AATGAAGTACAGAAACAGCCTGG + Intergenic
937599565 2:123714880-123714902 AATAAATGAAACAAAAAGCTAGG + Intergenic
937693903 2:124786527-124786549 AAGAAAGGAAAGAAAGAGAAAGG + Intronic
937924649 2:127158344-127158366 AAAAAAAGAAAAAAAGAGCTTGG - Intergenic
938264742 2:129919446-129919468 AAGAAAGGAAAGAAAGAGAAAGG + Intergenic
938601780 2:132849867-132849889 ATTAAGGAATAGAAAGAGCTTGG - Intronic
939043393 2:137220508-137220530 AATAAAGAACAGAAAGAAACTGG + Intronic
939251376 2:139685169-139685191 AAAAAAGGAAAGAAAGAGAAAGG + Intergenic
939447631 2:142330716-142330738 AATAAATGGCAGAAAATGCTTGG + Intergenic
939673813 2:145046854-145046876 AATAAAAGAGAAAAAGAGTTTGG - Intergenic
939733046 2:145808922-145808944 GATATAGGAAAGAAAGATCTGGG - Intergenic
939810233 2:146823020-146823042 AATCCAAGACAGAGAGAGCTTGG + Intergenic
939898123 2:147817453-147817475 AATAAAGGGCAGATTGATCTTGG + Intergenic
940201901 2:151161101-151161123 AATAAACCACAGAAAGAAATGGG + Intergenic
940309124 2:152258651-152258673 AACAAAGGACAGAAATGGATTGG - Intergenic
940608754 2:155963582-155963604 AATAAAGGACAGAGATTGATAGG + Intergenic
941238546 2:163007839-163007861 AATAGAAGACTGAATGAGCTAGG - Intergenic
941364756 2:164596461-164596483 AATAAAGGACAGAGAGAGAAAGG + Intronic
941443109 2:165563407-165563429 AATGAGGTACAGAAACAGCTGGG - Intronic
942175573 2:173330782-173330804 AATCAATGAAAGGAAGAGCTGGG - Intergenic
942307963 2:174627433-174627455 AAGAAAGGAAAGAAAGAGAAAGG - Intronic
943267366 2:185750894-185750916 AATCAATAACAGAAAGATCTTGG - Intronic
943334458 2:186597253-186597275 ACTATAAGACAGAGAGAGCTCGG - Intronic
943612503 2:190050181-190050203 AGTGAAGTACAGAAACAGCTTGG + Intronic
943691114 2:190870543-190870565 AATAAAGTAGAGATACAGCTGGG - Intergenic
943953870 2:194161861-194161883 AATAGAGGACAGGAAGATCAAGG - Intergenic
944980215 2:205108998-205109020 AAAAAAGAACAGAAAGCGATGGG - Intronic
945698245 2:213136072-213136094 AAAAAAGAAAAGAAAGAGCCGGG + Intronic
945976135 2:216272368-216272390 AATATAGGACAGGAGCAGCTGGG + Intronic
946072276 2:217044622-217044644 AATAAAGGAGAGAAAGAGGAAGG - Intergenic
946588271 2:221215222-221215244 AATCTGGGACAGAAATAGCTGGG + Intergenic
946811114 2:223526801-223526823 AAAAAAGGAGAGAGAGAGATTGG + Intergenic
946945946 2:224822721-224822743 AATAAAGAAAAAAAAGAGCCTGG + Intronic
947229280 2:227869033-227869055 AAGAAAGGAAAGAAAGAGGGAGG - Intergenic
947455658 2:230251474-230251496 AATAAAGGTCAGAATATGCTAGG + Intronic
947731840 2:232435545-232435567 AAAAAAGAAAAGAAAGAGCAAGG - Intergenic
948647351 2:239414317-239414339 AAGAAAGGAGAAAAAGAGGTGGG + Intergenic
1169301808 20:4448876-4448898 AATAATAGACAGAAATAGCAAGG + Intergenic
1169316452 20:4594430-4594452 ACAGAAGGACACAAAGAGCTTGG + Intergenic
1169813184 20:9629618-9629640 TATAAAAGAAAGGAAGAGCTCGG - Intronic
1170153479 20:13249143-13249165 AAATAAGGACACAAAGATCTGGG + Intronic
1172844966 20:37924590-37924612 AATAAACAAAACAAAGAGCTAGG + Intronic
1173165063 20:40682407-40682429 AAGCCAGGACAGGAAGAGCTTGG + Intergenic
1176521414 21:7827293-7827315 AATAAAATAAAGCAAGAGCTAGG - Intronic
1178227036 21:30732397-30732419 AATAAAGGACACAAAAAGGAAGG - Intergenic
1178655434 21:34457305-34457327 AATAAAATAAAGCAAGAGCTAGG - Intergenic
1178951816 21:36991411-36991433 AAAAAATGACAAATAGAGCTGGG + Intergenic
1179116662 21:38499641-38499663 AATAAAAGCCAGAATGACCTGGG - Intronic
1179135998 21:38680333-38680355 AATGAAGGAGAGTAACAGCTTGG + Intergenic
1180379239 22:12123572-12123594 AAGAAAGGAAAGAAAGAGAGAGG - Intergenic
1180920929 22:19521230-19521252 AAAAAAGGAAAGAAAGGGCATGG - Intergenic
1180925474 22:19550835-19550857 TAAAAAGGAAAGAAACAGCTGGG - Intergenic
1181934411 22:26428848-26428870 AATAAAGGAAAGAAGGCGTTAGG + Intergenic
1182240931 22:28915567-28915589 TATAAAGAACGGAAAGAACTGGG - Intronic
1182411006 22:30186342-30186364 AAAAAAGGACAGAAGGAGGGAGG - Intergenic
1182835953 22:33341488-33341510 AATAGAGGACAGAGGGAGCTGGG - Intronic
1183065577 22:35360433-35360455 AAAAAAAGAAAAAAAGAGCTGGG - Intergenic
1183219354 22:36502638-36502660 AAGAAAGGAAAGAAAGTGCTGGG - Intronic
1183476285 22:38037848-38037870 AACAAAGGATAGGAAGAGTTGGG - Intronic
1184116349 22:42424877-42424899 AAGAAAGGAAAGAAAGAGAGAGG - Intronic
1184218355 22:43082416-43082438 AATAAAGGCCAGACAGGGCGTGG + Intronic
1184343406 22:43898491-43898513 AATAAAAGTCAGCAAGAGATGGG + Intergenic
949216982 3:1582632-1582654 AATAAAATAAAGAAACAGCTTGG + Intergenic
950881947 3:16329256-16329278 TATAAAGGACAGACAGTTCTTGG - Intronic
950905124 3:16530921-16530943 AATAAGGGGCTGAAACAGCTGGG + Intergenic
951251314 3:20396959-20396981 AATAAAGGTGAGAAAGATCAAGG - Intergenic
951507302 3:23462174-23462196 GATAAAGTACAGAAAGTGTTAGG - Intronic
952025220 3:29072411-29072433 AAAAAGGGAGAGAAAGAGGTAGG - Intergenic
952619541 3:35321108-35321130 AAGAAAGGAAAGAAAAAGCGGGG - Intergenic
952671727 3:35976295-35976317 AATAAAAACCAGAAAGAGATGGG + Intergenic
952922897 3:38298848-38298870 AATAAAGGACAGGGGAAGCTGGG - Intronic
953024660 3:39137942-39137964 ACTAAAGGACAGAAAGAGATGGG + Intronic
953284831 3:41596503-41596525 AAGAGAAGACATAAAGAGCTGGG + Intronic
953337707 3:42107881-42107903 ACTGAAGGACAGGAAGAGCATGG - Intronic
953702999 3:45211034-45211056 AACAAAGAACCCAAAGAGCTAGG - Intergenic
953715233 3:45311748-45311770 AACAAATGACAGAAAGAGAACGG - Intergenic
954818338 3:53302572-53302594 AATAAAGTACAGTAAGAGGATGG + Intronic
955268756 3:57475230-57475252 AATAAAACACAGAAAGCACTAGG + Intronic
955427312 3:58805462-58805484 ATTAAAAGACAGAAAGAGATAGG - Intronic
956263662 3:67373713-67373735 AATAAACGAAAGAAAGAGGGAGG - Intronic
956495345 3:69819802-69819824 AAAAAAGTACAAAAAAAGCTGGG + Intronic
956790003 3:72673069-72673091 AAGAAAGGAAAGAAAGAGGGAGG + Intergenic
957665706 3:83222938-83222960 AATAAACTACAGAAAGAGTTTGG + Intergenic
957908851 3:86594827-86594849 ATTAAAGGAAAGCAAGACCTCGG - Intergenic
958597486 3:96246269-96246291 ACTAAAGAACAGAAGGTGCTAGG - Intergenic
958784399 3:98581856-98581878 GAGGAAGGCCAGAAAGAGCTGGG - Intronic
959818815 3:110707718-110707740 AAGAAAGTAGAGAAAGAGATAGG - Intergenic
959914593 3:111802323-111802345 AATAAAGGGGAGACAGAGCAAGG + Intronic
960327697 3:116317341-116317363 AAAAAAAGAAAGAAAGAGATTGG - Intronic
960434675 3:117611171-117611193 AATGAAGAACATAAAAAGCTAGG - Intergenic
960767798 3:121156483-121156505 AATAAAGTACATACAGAACTTGG - Intronic
961097856 3:124173381-124173403 AACAAAGGACAGACAGAATTGGG + Intronic
961209330 3:125113434-125113456 GACAAATGACAGAAAGAGATAGG - Intronic
961528715 3:127526337-127526359 AATCCAGGGCAGAAAGAACTTGG - Intergenic
961774443 3:129274192-129274214 AAAAAAAGAGAGAGAGAGCTGGG + Intronic
961916856 3:130385108-130385130 AATGAAGGATAGAATGAGCAAGG + Exonic
963921782 3:150912498-150912520 AATAAGGAACAAAAAGAGATCGG - Intronic
964020722 3:152007184-152007206 AATAAAGGAAAGAAAGAGGAAGG - Intergenic
964048446 3:152360492-152360514 CTTAAAGGACAGAGAGAGATGGG - Intronic
964131637 3:153294953-153294975 AATAAAGCATAGAAAGATTTTGG + Intergenic
964355094 3:155843289-155843311 AATAAAGAACTGAAAAGGCTTGG - Intronic
964468823 3:157029803-157029825 GATAAAGGACAGAAAGATTGAGG + Intronic
965173071 3:165293853-165293875 AAGAAAGGAAAGAAAGAGGGGGG + Intergenic
965207249 3:165737605-165737627 AATAAAGGACAGAAACCACAAGG + Intergenic
966335094 3:178859450-178859472 AAAAAAGAAAAGAAAAAGCTAGG + Intergenic
966412698 3:179659271-179659293 AAGAAAGGACAGAAAGACAGAGG - Intronic
966472958 3:180312340-180312362 AAGGAAGGAGAGAAAGAGCAAGG - Intergenic
967713010 3:192730882-192730904 AACAAAGGATAGGAGGAGCTGGG + Intronic
968072373 3:195793339-195793361 AAAAAAATACAGAAATAGCTGGG + Intronic
968470503 4:780027-780049 AATAAGTGACTGAATGAGCTGGG - Intergenic
970114465 4:12678609-12678631 AATAGAAGAAAGAAAGAGATTGG + Intergenic
970810369 4:20086389-20086411 CAAAAAGGAGAGAAAAAGCTTGG - Intergenic
971731772 4:30393150-30393172 AATAAAGCACAGTAAGATATAGG + Intergenic
972478335 4:39474443-39474465 AATAAAAAAAAGAAACAGCTAGG + Intronic
972676155 4:41261473-41261495 AACAGAGGCAAGAAAGAGCTTGG + Intronic
973272502 4:48276003-48276025 ACAAAAAGACAGAAGGAGCTGGG - Intergenic
973310704 4:48706713-48706735 AATAAGTTACAGAAAGAGCTTGG + Intronic
973710885 4:53629416-53629438 AAGCAAGGACAGAAAGATCCAGG - Intronic
974570062 4:63634053-63634075 AATAAAGCAAAGAAAGAATTTGG - Intergenic
974612639 4:64235689-64235711 AATAAAAGACATAAATAGTTTGG + Intergenic
974799915 4:66803190-66803212 AATAAAAGATAAAGAGAGCTAGG + Intergenic
975561063 4:75708807-75708829 AATAAAAAACAAAAATAGCTGGG + Intronic
976078814 4:81331126-81331148 AATAATGAACAGAAAGACCCAGG - Intergenic
977008865 4:91610432-91610454 AATAAATGAAATAAAGTGCTTGG - Intergenic
977726137 4:100299162-100299184 AAAAAAGGACAGAGAGAGATGGG + Intergenic
977839596 4:101686575-101686597 AATGAAGGAAAGAATGAGCTAGG - Intronic
978005594 4:103612288-103612310 AATAAAGCACACAAAGAATTAGG - Intronic
978649428 4:110982458-110982480 GATAAAGGACAGCAAATGCTTGG + Intergenic
978953649 4:114591208-114591230 AAAAAAAGAAAGAAAGAGATTGG - Intergenic
979187726 4:117819221-117819243 AATCAAGGACAAAAGGAGTTTGG + Intergenic
979582353 4:122375819-122375841 CACAGAGGACAGACAGAGCTAGG - Intergenic
980522830 4:133954192-133954214 AATAAAGAACAGGAAGATCAGGG - Intergenic
980866874 4:138562433-138562455 AAGAAAGAACAATAAGAGCTGGG + Intergenic
980941388 4:139278808-139278830 AATAAAGGCAATAAAGATCTAGG + Intronic
981144216 4:141306008-141306030 AAGAAAGGACAGAGGGAGTTTGG + Intergenic
981324727 4:143432573-143432595 ATTATAGAACAGAAAAAGCTGGG - Intronic
981368572 4:143931329-143931351 AATAAATAATAGAAAGATCTTGG - Intergenic
981849522 4:149213107-149213129 AAGAAAGCACAGAAAGATGTAGG + Intergenic
982130422 4:152224252-152224274 AAAAGAGGAGAGAGAGAGCTGGG + Intergenic
982223717 4:153146695-153146717 AATAAAAGACAGAACTGGCTGGG + Intergenic
982272656 4:153607080-153607102 AAGAAAGGACTGAAAAATCTAGG + Intronic
983310272 4:166051330-166051352 AAGAAAGGAAAGAAAGAGGAAGG - Intronic
983695524 4:170524995-170525017 AAAAAAGAACAAAATGAGCTGGG + Intergenic
983759815 4:171391912-171391934 AAGAAAGGACAGAAAAAGAAAGG - Intergenic
983850633 4:172576428-172576450 CATAAATGATGGAAAGAGCTTGG + Intronic
984508261 4:180647925-180647947 AATAAAAAAAAGAAAGATCTTGG + Intergenic
984655685 4:182315788-182315810 AATAAAGCACAGAAAAAGAATGG - Intronic
985082953 4:186284960-186284982 AATAAAATACAGAACGAGTTCGG + Intronic
1202760858 4_GL000008v2_random:109056-109078 AAGAAAGGAAAGAAAGAGAGAGG - Intergenic
985854285 5:2412959-2412981 AATAAAGGACACAGAGATTTAGG - Intergenic
986659543 5:10046630-10046652 AATACAAGACAGAAAGTGCCAGG + Intergenic
986792040 5:11171286-11171308 AATGAATGAGAGAGAGAGCTGGG + Intronic
987133414 5:14880036-14880058 AAAAAGAGACAGAAAGGGCTGGG + Intergenic
987347530 5:16991692-16991714 AGGAAAAGACACAAAGAGCTGGG + Intergenic
987610581 5:20198250-20198272 AAGAAAAGACAGAAAGATGTGGG + Intronic
987901217 5:24013898-24013920 AAGAAAGGAGAAAAAAAGCTAGG - Intronic
989283986 5:39678116-39678138 AAAAAAAAACAGAAACAGCTGGG - Intergenic
989436067 5:41415244-41415266 TAAAAAGTACAGAAAGAGCAGGG - Intronic
989602617 5:43213922-43213944 AAAGAAAGAGAGAAAGAGCTAGG - Intronic
989736073 5:44708547-44708569 AATAAATGACAATAAGAGATGGG + Intergenic
990080871 5:51911979-51912001 AGCAAAGGACAGAAGGAGCAAGG + Intergenic
990129343 5:52561255-52561277 AATAAAGCACATTAAGAGCTAGG - Intergenic
990302932 5:54466933-54466955 AATAGAGCACAGAAAGACCAAGG - Intergenic
990624057 5:57592041-57592063 ATTCAATGAGAGAAAGAGCTTGG + Intergenic
990974330 5:61544502-61544524 AATAAAGGAAAGAAAGAAATAGG - Exonic
991292086 5:65042916-65042938 AATGAAGGACAGAGAGAGAGTGG + Intergenic
991569511 5:68039828-68039850 CATAAATGACACAAAGAGGTAGG - Intergenic
992332399 5:75730726-75730748 AATATGGGACAGAAGGAGCCAGG + Intergenic
992549310 5:77846139-77846161 AATATAGGACAGAAGAATCTGGG - Intronic
993277967 5:85886665-85886687 AATAAAGTACAGAAATAGCTTGG - Intergenic
993288227 5:86030007-86030029 ACTAAAGGACAGAGTGACCTGGG + Intergenic
993566146 5:89477835-89477857 TTTAAAGGAAAGAAAGAACTAGG + Intergenic
994365547 5:98912908-98912930 AATAAAGGAAAGAAAAAGTAGGG - Intronic
994508564 5:100673504-100673526 AAAAAAAGGCAGAAAAAGCTAGG - Intergenic
994577100 5:101592521-101592543 TATAAAGAACAGCAAGAGCTAGG + Intergenic
994599394 5:101883151-101883173 AATAAAGGAAATAAAAATCTAGG + Intergenic
994977643 5:106830428-106830450 AATAAATTAGAGCAAGAGCTGGG + Intergenic
995372602 5:111436031-111436053 AAAAATGAACAGAAAAAGCTAGG - Intronic
995391329 5:111643033-111643055 AAGTAAGCACGGAAAGAGCTTGG - Intergenic
995466740 5:112457579-112457601 AATAAAGAACAGCAAGCCCTAGG + Intergenic
995515425 5:112950270-112950292 AAGAAAGGGAAGAAAGAGATGGG - Intergenic
995574746 5:113517679-113517701 AAAAAAAGAGAGAAGGAGCTAGG - Intronic
995778171 5:115747591-115747613 AAACAAAGAAAGAAAGAGCTAGG - Intergenic
996007459 5:118440084-118440106 AATAAAGGAGACAGAGAGCAAGG + Intergenic
996610416 5:125372253-125372275 AAAAAGGGAGAGAAAGCGCTGGG - Intergenic
997553445 5:134773665-134773687 AATAAAAGAAAGAAAGAGATGGG - Intronic
997589942 5:135066398-135066420 AATCAGGCACAGAAAGAGCAAGG - Intronic
997763782 5:136478133-136478155 ACTAAAGGATAGAAAGAGGGAGG + Intergenic
998638825 5:143986603-143986625 AATAATGGGCAGAGTGAGCTGGG + Intergenic
998967777 5:147559389-147559411 AATAAAGGCTAGAAAGATTTAGG - Intergenic
999225134 5:150015582-150015604 TAGAAAAGAAAGAAAGAGCTGGG - Intronic
999774235 5:154799531-154799553 AATCTTGGACAGAAAGATCTTGG - Intronic
1000089431 5:157917438-157917460 TATAAAGAAAAGAAATAGCTGGG - Intergenic
1000677174 5:164136095-164136117 AAAAAAAGACATAAAGAGATGGG + Intergenic
1000911683 5:167030462-167030484 AAAAAAAGAGAGAAAGCGCTGGG - Intergenic
1001284723 5:170414476-170414498 AGTGAGGGACAGAAACAGCTGGG - Intronic
1001389024 5:171363544-171363566 AAAAAAGGACAGAGAGAGAAAGG + Intergenic
1001448441 5:171805815-171805837 AAGAAAGGAAAGAAAGAATTTGG + Intergenic
1001474695 5:172042253-172042275 TATAAGGGACAGACAGAACTGGG - Exonic
1001887804 5:175311307-175311329 AACATGGGACAGAAGGAGCTTGG + Intergenic
1001949284 5:175804937-175804959 AGTTAAGTATAGAAAGAGCTTGG - Intronic
1003659789 6:8049381-8049403 AAGAAAGGAAAGAAAGAACGTGG + Intronic
1003715257 6:8639269-8639291 AATAGAGGCCAGAAAGAGAGAGG - Intergenic
1004042567 6:11995047-11995069 AATACAGGTCAGAAAGCTCTGGG + Intergenic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004372960 6:15068110-15068132 AATAAAGAAATGAATGAGCTGGG - Intergenic
1004395095 6:15240833-15240855 AAAGAAAGAAAGAAAGAGCTGGG - Intergenic
1004999051 6:21222625-21222647 AATAAAGGAGAAAGATAGCTTGG + Intronic
1005314826 6:24594809-24594831 AATAAAGTAAAAAAAAAGCTTGG - Intronic
1006151196 6:31991163-31991185 GACAAAGGACAGAGAGAGGTGGG - Intronic
1006157497 6:32023901-32023923 GACAAAGGACAGAGAGAGGTGGG - Intronic
1006761933 6:36470575-36470597 AATAAAGTAAAGAAAAAGCAGGG - Intronic
1006854285 6:37122415-37122437 AAGAAAGGAAAGAAAGAGGCTGG - Intergenic
1007259629 6:40554475-40554497 ACAAAATGACAGAAACAGCTTGG + Intronic
1008277701 6:49560318-49560340 AAAAAAGAAAAGAAAGAGATTGG + Intronic
1009389247 6:63125949-63125971 GAAAAACGAAAGAAAGAGCTTGG - Intergenic
1011029338 6:82904547-82904569 AATAAAGGACATAAATGGCCTGG + Intronic
1011135955 6:84100969-84100991 AATAAAAGACTGAGAGATCTTGG - Intergenic
1011655838 6:89551314-89551336 AAAAAAAGGCAGGAAGAGCTGGG - Intronic
1012297191 6:97539612-97539634 AATATAGGACAGTAACAACTAGG + Intergenic
1012322135 6:97862799-97862821 CATAAAGGTCAGAAAGATCCTGG + Intergenic
1012794746 6:103745016-103745038 AACCAAGGAGAGACAGAGCTGGG + Intergenic
1014262722 6:119238003-119238025 AAGAAAAGGCAGAAAGAGCAGGG - Intronic
1014534680 6:122600473-122600495 AGAAAAGGGCACAAAGAGCTGGG + Intronic
1014923333 6:127239470-127239492 AACAATGGACAGAAAGATCTTGG - Intergenic
1015373098 6:132478572-132478594 CATCAAGGACAGAAAGAGCAGGG + Intronic
1015637315 6:135290138-135290160 TTTAAAGGAAAGAAAAAGCTAGG - Intronic
1015900865 6:138064489-138064511 TAAAAAGAACAGAAAAAGCTTGG + Intergenic
1016225504 6:141730191-141730213 AACCAATAACAGAAAGAGCTAGG + Intergenic
1018158024 6:161007543-161007565 TATAAAGGACAGAATGAGTTGGG - Intronic
1018344988 6:162891100-162891122 ACTAAAGGACAGGAAGAGCCCGG + Intronic
1018403587 6:163452492-163452514 AACAAAGGCAAGAAAGAGCTAGG - Intronic
1018613978 6:165668734-165668756 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1019073948 6:169371650-169371672 AGTGAAGGAGAGAAAGAGCTAGG + Intergenic
1019198950 6:170298137-170298159 AGGAAAGGAAAGAAAGAGCTTGG - Intronic
1019291657 7:253484-253506 AATAAAAGACACAAACAGCAAGG - Intronic
1020235676 7:6353515-6353537 AAGAAAGGAAAGAAAGAGGTGGG + Intergenic
1020793511 7:12655877-12655899 AAGAAAGAACAGAAAGACCCAGG + Intergenic
1020817538 7:12924006-12924028 AATAAAGTAGAAAATGAGCTAGG + Intergenic
1021693947 7:23258045-23258067 AAAAAAAGACAGAATGGGCTAGG - Intronic
1021930025 7:25571076-25571098 ACTACACGACAGAATGAGCTAGG + Intergenic
1022245641 7:28556684-28556706 AAAAAGGGACAGAATGGGCTTGG - Intronic
1023088205 7:36593522-36593544 AAGACAGGACAGAACCAGCTAGG - Intronic
1023204328 7:37731794-37731816 AAGAAAGGACAGAAAGCGATTGG - Intronic
1023635428 7:42204715-42204737 AATCAAGCTCAGAAAGAGGTTGG - Intronic
1023645484 7:42308790-42308812 AATCAATGAAACAAAGAGCTGGG + Intergenic
1023709511 7:42976822-42976844 AAAAAAGAAGAGAGAGAGCTAGG - Intergenic
1024360827 7:48465819-48465841 AATAGGGGAGAGAAAGAGGTTGG - Intronic
1024686449 7:51750988-51751010 AATAAAGAACTGAAAGGGTTTGG - Intergenic
1024737191 7:52318529-52318551 AATAAAAGTAAGAAAGAGCCGGG + Intergenic
1024929778 7:54657872-54657894 CATAAAGGGCACAAAGAGCCAGG - Intergenic
1024957537 7:54940025-54940047 AAGAAAAGAAAGAAAGAGCAGGG + Intergenic
1025753413 7:64312578-64312600 AGTAAAGGCCTGGAAGAGCTGGG - Intronic
1025933208 7:66012908-66012930 CATACATGAGAGAAAGAGCTAGG + Intergenic
1026132661 7:67633214-67633236 AATAAAACACAGAAAGTGCCTGG - Intergenic
1026284960 7:68955008-68955030 AAGAAAGGAGAGAGAGAGCAGGG + Intergenic
1026392891 7:69920280-69920302 AATAAAAGAAAGAAAGAGAGAGG - Intronic
1026659328 7:72285536-72285558 AAAAAAGTACAGTAAGAGCTGGG - Intronic
1027333904 7:77127739-77127761 AGTAAAGAATAGAAAGAGCAAGG - Intronic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1027823052 7:83073036-83073058 AATAAAGATCAGAAATAGCATGG - Intronic
1028076430 7:86521859-86521881 AATAAAGGACAGGGATATCTTGG + Intergenic
1028475702 7:91250864-91250886 AATTGAGGACTGAAACAGCTGGG - Intergenic
1028642092 7:93053833-93053855 GAGAAAGGAAAGGAAGAGCTGGG + Intergenic
1028815984 7:95145611-95145633 ACTAAAAGACAGAAATTGCTGGG + Intronic
1028948466 7:96607576-96607598 AATAAAGTAGAGAAACAACTAGG + Intronic
1029249364 7:99225057-99225079 AAGAAAGGAAAGAAAGAGGAAGG - Intergenic
1029486927 7:100848921-100848943 AAAGAAAGAAAGAAAGAGCTAGG + Intronic
1029781886 7:102743575-102743597 AGTAAAGAATAGAAAGAGCAAGG + Intergenic
1030338022 7:108346595-108346617 AATAGAGGACAAAAAGTGCTGGG + Intronic
1031018963 7:116605998-116606020 AAGAAAGGAGAGAAAGAGGAAGG + Intergenic
1031208935 7:118797051-118797073 AATGAGGTACAGAAACAGCTGGG - Intergenic
1031590053 7:123580046-123580068 AATAAAGGAGGAAAAGAGATTGG + Intronic
1031600348 7:123700326-123700348 AATGAAGGACAGTAAGAGTCAGG + Intronic
1031678616 7:124642662-124642684 AATTAAGGAAACAAAAAGCTAGG + Intergenic
1031982384 7:128136186-128136208 AATAAATGACAGAAGGGGCGTGG + Intergenic
1032150019 7:129420638-129420660 AAAAAAGAACAGAATTAGCTGGG - Intronic
1032280232 7:130493810-130493832 AGTACAGGACAGATAGGGCTGGG + Intronic
1032928242 7:136634775-136634797 AATAAAGGAAATAAAGAACCAGG - Intergenic
1033326483 7:140383306-140383328 ATTAAAAGAAAGAAGGAGCTGGG + Intronic
1034134564 7:148754468-148754490 TTTAAAAAACAGAAAGAGCTGGG - Intronic
1035451257 7:158978373-158978395 AATAGAAGACAGCAAGTGCTCGG - Intergenic
1036221048 8:6921902-6921924 AAGCAAGGACAGAGAGAGCACGG + Intergenic
1036529740 8:9573352-9573374 AGTAAGGTATAGAAAGAGCTTGG + Intronic
1037131198 8:15409725-15409747 AGTAAGGTACAGAAACAGCTGGG + Intergenic
1038159129 8:25020059-25020081 AATAAAGTACAGAAGTAGTTTGG + Intergenic
1038724234 8:30065930-30065952 AGTAAAGTACAGAAATAGTTTGG - Intronic
1039358964 8:36854042-36854064 AATAGAGGCCAGAAAGAAGTAGG - Intronic
1039365664 8:36925651-36925673 AATAAAGGAGACAATGAGATTGG - Intronic
1039380751 8:37082737-37082759 ATTAAAGAACTGGAAGAGCTAGG + Intergenic
1041318604 8:56590704-56590726 AATTAAAGGCACAAAGAGCTTGG + Intergenic
1041947644 8:63464182-63464204 AATAAAGCACAGAAGGTGCCTGG - Intergenic
1042105635 8:65323523-65323545 AGTAAAGGATAAGAAGAGCTTGG - Intergenic
1042456853 8:69015268-69015290 GATGAAGGAAAGAAAGAGATGGG + Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1042893759 8:73642936-73642958 AATAAAGGTCTGAAAAAGCAGGG + Intronic
1042994873 8:74685990-74686012 AATAAAGAACTGAGAGAGCAAGG - Intronic
1043164535 8:76886841-76886863 AAAAAAGGAAGGACAGAGCTAGG - Intergenic
1043391040 8:79791933-79791955 AATAAAAGACAAAATGAGCGGGG - Intergenic
1043603644 8:81972446-81972468 TAAAAAGGACATAAAGACCTAGG + Intergenic
1044011625 8:87000798-87000820 TACAAAGGAGAGAAATAGCTAGG - Intronic
1044246564 8:89954251-89954273 CATAGAGGACACAAAGACCTGGG + Intronic
1044609595 8:94078759-94078781 AATAAAAAAAATAAAGAGCTGGG - Intergenic
1044732977 8:95246845-95246867 ATTAAAGGATAGAAAGTACTTGG + Exonic
1046194911 8:110849523-110849545 ATTAAAGGACACAAATAGTTGGG + Intergenic
1047503845 8:125463347-125463369 AAGAAAGCACAGAAACAGATAGG - Intergenic
1047926834 8:129690417-129690439 AATAGAGGACAAGGAGAGCTTGG + Intergenic
1047943170 8:129847166-129847188 TTTAAAGGACAGAATGGGCTGGG + Intronic
1048376549 8:133827591-133827613 CTTAAAGCAGAGAAAGAGCTAGG + Intergenic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048480688 8:134789645-134789667 CATAAAGAACAGAAAAAGCCTGG + Intergenic
1048813701 8:138311173-138311195 AATAGAGAAAAGAAAGAGATGGG + Intronic
1049167394 8:141135129-141135151 AAAGAAAGAAAGAAAGAGCTGGG - Intronic
1050538824 9:6652480-6652502 AAAAAAGAAAAGAAAGGGCTGGG + Intergenic
1050563191 9:6855644-6855666 GAGAAAGGACAGGAAGAGATAGG - Intronic
1050602063 9:7262948-7262970 ACTAAAAGACAGAAAGAGCATGG - Intergenic
1051381410 9:16462792-16462814 AACAAAGAACAGAAAGAGGGAGG - Intronic
1051463500 9:17350993-17351015 AATCAAAGACAGAAAAATCTAGG + Intronic
1051557611 9:18402592-18402614 AAGAAAGGACTGAAAGATATAGG - Intergenic
1051995821 9:23216468-23216490 AACAGAGGAAAAAAAGAGCTTGG - Intergenic
1052061704 9:23967441-23967463 AATCAAGAAAATAAAGAGCTGGG - Intergenic
1052759846 9:32579003-32579025 AATACAGGTCATAAAGACCTTGG + Intergenic
1052977893 9:34425098-34425120 AATAAAAGTGAGAAAGGGCTGGG - Intronic
1055149169 9:72974589-72974611 AACCAAGGACAGAAAAACCTTGG + Intronic
1055178939 9:73358762-73358784 AATCAAGGAAAGAAAGACTTGGG - Intergenic
1057474800 9:95389346-95389368 AATAAAGGAAAGAAAGGTCTTGG - Intergenic
1058046042 9:100357861-100357883 AATAAAATACAAAAACAGCTGGG - Intergenic
1058344558 9:103945587-103945609 AAAAAAAGACAGAAACAGTTTGG - Intergenic
1058397937 9:104577498-104577520 GGTAAAGGACAGTAAGCGCTAGG + Intergenic
1059061138 9:111036893-111036915 AATCAAGGGCAGAAAGAACTAGG + Intronic
1059127479 9:111705410-111705432 AAAAAAAAAGAGAAAGAGCTGGG - Intronic
1059305832 9:113352390-113352412 AATAAAGCAAAGTAAGAGATTGG + Intronic
1059831541 9:118101674-118101696 AAAAAAGGACAGATACATCTGGG + Intergenic
1059856970 9:118410080-118410102 AATACAAGACAGAAAGAGGAAGG + Intergenic
1060056876 9:120421646-120421668 AATAAAGGAGGGCAAGACCTTGG + Intronic
1060291997 9:122312146-122312168 AATACAGGCCAGAAAGATCGGGG + Intronic
1060775134 9:126367433-126367455 AAGAAAGGACAGAAAAGGCCAGG - Intronic
1061286005 9:129623036-129623058 AAAAAAAGAAAGAAAGAGCCGGG + Intronic
1061688756 9:132306874-132306896 AATAAAATAGATAAAGAGCTGGG - Intronic
1061735089 9:132649468-132649490 ACAAAAAGACAGAAAGAGCTTGG + Intronic
1203541627 Un_KI270743v1:93939-93961 AAGAAAGGAAAGAAAGAGAGAGG - Intergenic
1186124755 X:6401177-6401199 AATAAGGGCCAAACAGAGCTGGG - Intergenic
1186652477 X:11575806-11575828 TATAAAACAGAGAAAGAGCTTGG + Intronic
1187006617 X:15239130-15239152 AGTAAAGAACAGGAACAGCTAGG - Intronic
1187270120 X:17772610-17772632 AAAAAAAGACAGGAAGAGATGGG - Intergenic
1187586137 X:20663894-20663916 CATAAAGGACAGACATAGCAGGG + Intergenic
1187631613 X:21179087-21179109 AAAAAGGCAGAGAAAGAGCTAGG + Intergenic
1187719048 X:22132687-22132709 AATAAAGGACTGAGAGAGACAGG - Intronic
1188507677 X:30900210-30900232 AACAAAGGTCAGCAAGATCTTGG - Intronic
1189198920 X:39175275-39175297 AATAAAAGACAGACAGAGAGAGG + Intergenic
1189300661 X:39949879-39949901 AAAAAAGGACAAAAAGAAGTGGG + Intergenic
1189517834 X:41733188-41733210 AAAAAAGGAGAGAGAGAGATAGG + Intronic
1189585505 X:42457039-42457061 AAGAAAGGAAAGAAAGAGAAAGG - Intergenic
1189586343 X:42466114-42466136 AATAAAGCACTTAAAGAGCTGGG + Intergenic
1190259470 X:48789008-48789030 ACAAAAGCACAGAAAGAGGTCGG + Intronic
1190313484 X:49134049-49134071 AAAGAAGGAAAGAAAGAGCCTGG - Intergenic
1190994549 X:55593533-55593555 AATAAAGGATAGAAGAACCTTGG - Intergenic
1191220060 X:57978319-57978341 AATAAAGCACAGAAGCATCTGGG - Intergenic
1191222098 X:58000125-58000147 AATGAGGTAAAGAAAGAGCTAGG + Intergenic
1191944103 X:66512641-66512663 AATAAAAAACAAAAAGAGCAGGG - Intergenic
1192894890 X:75432022-75432044 GATAAAGGAAATAAAGATCTGGG + Intronic
1193119466 X:77808149-77808171 AGAAAAAGAAAGAAAGAGCTGGG - Intergenic
1193640281 X:84003606-84003628 GATAAAGGTCAGAATGACCTGGG - Intergenic
1193798980 X:85913034-85913056 AAAAAAGGAAAGAAAGAGGCAGG + Intronic
1194327545 X:92539194-92539216 AGAAAAGTACAGAAAGAGATGGG - Intronic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1194462981 X:94196070-94196092 AGAAAAGGACAGGAAGAGGTGGG + Intergenic
1194468636 X:94264546-94264568 TATAAAAGACAGAAGGAACTGGG + Intergenic
1194707684 X:97195018-97195040 AATAAAGGACAACAAAACCTAGG + Intronic
1196116180 X:112002046-112002068 TATAAAGGACAGAAGCAGCCAGG - Intronic
1196790128 X:119457208-119457230 AAGAAAGGAGAGAAAGAACGAGG + Intergenic
1196790133 X:119457262-119457284 AAGAAAGGAGAGAAAGAACGAGG + Intergenic
1196863038 X:120045441-120045463 CAGAATGGGCAGAAAGAGCTGGG - Intergenic
1196880064 X:120190903-120190925 CAGAATGGGCAGAAAGAGCTGGG + Intergenic
1196924563 X:120620655-120620677 AATTAATGACAGGAAGAGTTTGG + Intronic
1196984594 X:121254189-121254211 AGTAGAGGAGAGAAAGAGTTGGG - Intergenic
1197007355 X:121517599-121517621 GAAAAATGACAGAAATAGCTGGG - Intergenic
1197751369 X:129966041-129966063 AATAAAGTACACAGTGAGCTTGG + Intergenic
1198416871 X:136429194-136429216 AAGAAAGAACACAAAAAGCTTGG - Intergenic
1198982124 X:142409894-142409916 GAAGAAGGAGAGAAAGAGCTAGG + Intergenic
1199791289 X:151157535-151157557 GAGAAAGAACAGAAAGAGCTTGG + Intergenic
1199851742 X:151728807-151728829 GATAAAGGAAAGGAAGAGCTGGG + Intergenic
1200636259 Y:5658412-5658434 AGAAAAGTACAGAAAGAGATGGG - Intronic
1200836487 Y:7737302-7737324 AAAAAATGAAAGAAAGAGGTGGG + Intergenic
1201907123 Y:19096927-19096949 AATAAAAGAGAGAAAGAGAGAGG - Intergenic
1202277800 Y:23143669-23143691 AGTAAATGACAGAAAGAAGTAGG + Intronic
1202287403 Y:23265098-23265120 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202287568 Y:23267482-23267504 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202287733 Y:23269867-23269889 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202287897 Y:23272251-23272273 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202288061 Y:23274635-23274657 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202288227 Y:23277019-23277041 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202379758 Y:24265821-24265843 AAAAAAAGAAAGAAAGAGGTAGG + Intergenic
1202439343 Y:24883155-24883177 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202439507 Y:24885540-24885562 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202439671 Y:24887925-24887947 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202439836 Y:24890309-24890331 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202440002 Y:24892694-24892716 AGTAAATGACAGAAAGAAGTAGG - Intronic
1202491024 Y:25404300-25404322 AAAAAAAGAAAGAAAGAGGTAGG - Intergenic