ID: 903099232

View in Genome Browser
Species Human (GRCh38)
Location 1:21013789-21013811
Sequence ACTCCTGATGTTACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903099230_903099232 -5 Left 903099230 1:21013771-21013793 CCTTCACACCAGGCTGATACTCC 0: 1
1: 0
2: 1
3: 23
4: 297
Right 903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG 0: 1
1: 0
2: 0
3: 6
4: 110
903099229_903099232 2 Left 903099229 1:21013764-21013786 CCTTAAGCCTTCACACCAGGCTG 0: 1
1: 0
2: 1
3: 21
4: 237
Right 903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903099232 Original CRISPR ACTCCTGATGTTACCCATCA TGG Intronic
900794101 1:4697683-4697705 TCTCCCCATGTTACCCATGAGGG - Intronic
902277605 1:15350704-15350726 ACTCCTCATGTTACACCTCTAGG - Intronic
903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG + Intronic
904846599 1:33423426-33423448 TCTCATGATTTTAGCCATCAAGG + Intronic
919887823 1:201947646-201947668 AGCCCTGGTGTAACCCATCAGGG + Intergenic
921154292 1:212426787-212426809 ACTCCTGATATTACTCTTAAAGG + Intergenic
922236373 1:223725746-223725768 CCTCCTGATGTTTCCCACAAAGG + Intronic
923250944 1:232179187-232179209 ACTCCAGGTCTTACCCACCAAGG - Intergenic
1064644798 10:17450182-17450204 CCTACTGATGTTACCTTTCAGGG - Intronic
1065262250 10:23936237-23936259 ACCCATGATGTCACCCATAAAGG + Intronic
1067993607 10:51243631-51243653 TTTCCTGATGTAATCCATCATGG + Intronic
1069166128 10:65162198-65162220 ACTTCTGTTTTTACCCATGAGGG + Intergenic
1070117782 10:73545476-73545498 ACTGCTGATGGTCTCCATCAGGG - Intronic
1070580706 10:77717038-77717060 GCTCATGATGTCACCCATCCAGG - Intergenic
1071120512 10:82271368-82271390 AATCATGATGCTACCTATCAGGG + Intronic
1078043415 11:7890624-7890646 AATCCAGATGTTTCCCTTCACGG - Intergenic
1078116641 11:8459449-8459471 ACTCCTGCTTGTACCCATAATGG + Intronic
1079789898 11:24723628-24723650 TCTCATGATGTTTCCCAGCAGGG - Intronic
1081028196 11:38042710-38042732 ACTTATGAGGTTTCCCATCATGG + Intergenic
1083058030 11:59841971-59841993 ACTCGTGATATTTCCCTTCATGG - Intronic
1083649593 11:64193885-64193907 ACTCCTTATGTTACCCAGGCTGG - Intronic
1086447728 11:86886088-86886110 ATTACAGATGTTAGCCATCATGG - Intronic
1089083792 11:115799762-115799784 ACTCCTCATGTTAGCATTCATGG - Intergenic
1091824968 12:3505314-3505336 ACCCATGATGTTACTCAACACGG + Intronic
1095792347 12:46181456-46181478 ACACCTAATATTAACCATCACGG - Intergenic
1099016917 12:77354318-77354340 AATTCTGCTGTTACCCATAACGG + Intergenic
1101295696 12:103421372-103421394 TCTCCTGATGTTGCCCATGCTGG - Intronic
1101427919 12:104602976-104602998 ACTCCTGAATTTATGCATCATGG + Intronic
1103956138 12:124577945-124577967 AGTCCTGCTGAAACCCATCAGGG - Intergenic
1119618790 14:76116254-76116276 GCTTCTGATGTTGCCCAGCATGG + Intergenic
1128611437 15:69076741-69076763 ACTTCTGATTTCACCCATCTGGG - Intergenic
1132368850 15:101278573-101278595 ACTCTGGATGTTATCCATAAAGG + Intergenic
1133130653 16:3674443-3674465 ACTCCTCATGTTGCCACTCACGG + Exonic
1133641709 16:7723488-7723510 TCTCCTGATGTTACCCAGCCTGG - Intergenic
1137818250 16:51420084-51420106 TTTCCTGATATTTCCCATCAGGG + Intergenic
1139232188 16:65294408-65294430 ACTTCTGAGGTTACAGATCAAGG - Intergenic
1141021974 16:80505847-80505869 TCTCCTTATGGTACCCATAAGGG + Intergenic
1141270030 16:82531210-82531232 ACTCTTGATGTTTCGCTTCATGG + Intergenic
1146931865 17:36783318-36783340 ACCCCTGATGATACACCTCAGGG + Intergenic
1148100493 17:45087559-45087581 AGTCCTGAAGTCAGCCATCAAGG - Intronic
1150785600 17:68160836-68160858 ACTCCTGATCTCACCCACCTTGG + Intergenic
1151364610 17:73609111-73609133 ACTCCTGATCTTCCCCAAAAAGG - Intronic
1158607927 18:58912284-58912306 AAACCTGATGATACCAATCATGG - Intronic
1164983408 19:32630825-32630847 ACTCATGATGTTACCCAGGCTGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
925553361 2:5101013-5101035 ACACCTAATATTAACCATCACGG - Intergenic
926496577 2:13595630-13595652 ACTCCTGAAGCTAACCATAATGG - Intergenic
931658683 2:64535854-64535876 ACTCCTTATCTTAGCCAACATGG - Intronic
942535815 2:176962296-176962318 TCTTCTGATGTTAATCATCAGGG - Intergenic
1170721912 20:18888855-18888877 ACAGCTGATGTTGACCATCACGG + Intergenic
1173730909 20:45327866-45327888 ACTCCTGACCTTGCCCATCTCGG + Intronic
1174404374 20:50294053-50294075 ACCCCTGCTGATTCCCATCACGG - Intergenic
1175271737 20:57738872-57738894 ACACCAGATGTTAGCCTTCAAGG + Intergenic
1177904517 21:26959286-26959308 ACTCCTGATGTTAATGATGAGGG - Intronic
1178723893 21:35034542-35034564 ATTCCAGATTTTACCCCTCAGGG + Intronic
1180849953 22:19012585-19012607 TCTCCTTATGTTGCCCATGATGG + Intergenic
949124955 3:436087-436109 TCTCATGATGTTAGCCATCTAGG + Intergenic
954037662 3:47860894-47860916 ACCACTGAGCTTACCCATCAAGG + Intronic
955592903 3:60556967-60556989 TCTCCTGATGATACCCATGAAGG + Intronic
956108564 3:65847626-65847648 ACTCTTGAGCTTACACATCATGG + Intronic
957320204 3:78620285-78620307 ACTCCTGATGCCACCCACCTTGG - Intronic
957989576 3:87611982-87612004 ACTCCTGATGAAACCCACCAGGG - Intergenic
960747568 3:120907604-120907626 ACCCCTGCTGTTACCAATAATGG - Intergenic
964630833 3:158808592-158808614 ACTCCTTTTGTTGCCTATCATGG + Intronic
971336152 4:25725763-25725785 ACTCCGGAAGTTACCCCACATGG - Intergenic
971770753 4:30893703-30893725 ACTCCTGGTGTTACACACAAAGG - Intronic
973996140 4:56460988-56461010 ATTGCTGATGTGACCCATGAAGG + Exonic
979315912 4:119263150-119263172 ACTTCTGATTCTACCCATGAAGG + Intronic
980290131 4:130838279-130838301 ACTCCTGATGAGACAGATCAAGG + Intergenic
982389166 4:154846090-154846112 CCTCATGATGTTTCCCATGATGG + Intergenic
984103373 4:175514526-175514548 ACACCTAAAGTTAACCATCACGG + Intergenic
984242664 4:177236634-177236656 ACCCCTTATGTGCCCCATCAGGG + Intergenic
986237216 5:5922731-5922753 ACGCCTGATGATACACATAATGG - Intergenic
989756871 5:44966050-44966072 ACCCCTACTTTTACCCATCAGGG - Intergenic
990011123 5:50999611-50999633 TCTCCTGATGTTACCCAGGCTGG + Intergenic
990328275 5:54699313-54699335 ACTCCTGATGTTAGGCAATAAGG - Intergenic
992944703 5:81798701-81798723 GCTCCTGTAGTTACCCAGCAGGG + Intergenic
995287559 5:110408706-110408728 ACTCCTGATGTTACTTATTTGGG - Intronic
998521062 5:142800961-142800983 TGACCTGATGTTCCCCATCAGGG - Intronic
998968173 5:147563210-147563232 TCTCCTGATGTTGCCCAGCCTGG + Intergenic
1007159176 6:39775086-39775108 ACTCCTGGGGATACCCATAAGGG + Intergenic
1007278679 6:40694109-40694131 AGTTCTGATGTTAACTATCAGGG + Intergenic
1007735376 6:43979040-43979062 GCTCCTGAAGTTATGCATCAGGG + Intergenic
1012426413 6:99119817-99119839 ACTGCAGAGGTGACCCATCAAGG + Intergenic
1014624656 6:123710853-123710875 ACCCCTGGGGTTACCCATAAGGG - Intergenic
1017036760 6:150274053-150274075 CCTTCTGCTGTTACCCATGAAGG - Intergenic
1017884772 6:158589746-158589768 ACACCTGAAGCTCCCCATCAAGG + Exonic
1018494839 6:164338418-164338440 AGTCCAGATGTTACCCAAAAGGG - Intergenic
1021324367 7:19247274-19247296 ACACTTAATGTTAACCATCATGG + Intergenic
1022640732 7:32180264-32180286 ACTCCTTATCATACACATCAGGG + Intronic
1023250725 7:38257793-38257815 ACTTCTGATGCTTCCCCTCATGG - Intergenic
1025096716 7:56101486-56101508 ACTCCTTATATAACCCCTCAGGG + Intergenic
1026048165 7:66922012-66922034 ATTTCTGATGGTCCCCATCAAGG - Intronic
1028470066 7:91196261-91196283 ACTCTTGAAATCACCCATCATGG - Intronic
1032658956 7:133962115-133962137 TCTCCTGAGGTCACACATCAAGG + Intronic
1034836995 7:154361933-154361955 ACTCCAGATGTGAGCCATCATGG - Intronic
1035194895 7:157209629-157209651 ACACCTGATATTGCACATCATGG - Intronic
1036444600 8:8810682-8810704 ACTACTGATGTTATCCGTTAAGG + Intronic
1043001814 8:74768805-74768827 ACACCTAATATTAACCATCACGG + Intronic
1044522459 8:93215207-93215229 ATTCTTTATGTTTCCCATCAGGG + Intergenic
1045677255 8:104620859-104620881 TTTCCTGATGTTCCCAATCATGG - Intronic
1055286866 9:74738319-74738341 ACTCCATATATTACCCATCCTGG + Intronic
1055424640 9:76181566-76181588 TATCCTGATATGACCCATCAGGG - Exonic
1055697253 9:78899483-78899505 ACTCCTGATGTCACCTTCCATGG + Intergenic
1059985715 9:119818487-119818509 ACACCTAATATTAACCATCACGG - Intergenic
1185603005 X:1352886-1352908 ACTCATGATGAAACCCATCATGG - Intronic
1185603031 X:1352988-1353010 ACTCATGATGAAACCCATGATGG - Intronic
1185603131 X:1353332-1353354 ACTCATGATGGGACCCATGATGG - Intronic
1185603165 X:1353467-1353489 ACTCATGATGGAACCCATGATGG - Intronic
1186288205 X:8068577-8068599 ACACCTAATATTAACCATCACGG - Intergenic
1186811293 X:13191320-13191342 ACACCTAATATTAACCATCACGG - Intergenic
1187460632 X:19483903-19483925 ACTACTAATGGTACCCCTCAAGG + Intronic
1190010586 X:46781157-46781179 ACACCTAATATTAACCATCACGG + Intergenic
1194960403 X:100228650-100228672 AATCCTGATGTTAACAAACAGGG - Intergenic
1195284133 X:103366930-103366952 TCTTCTAATGTTACCCCTCAGGG + Intergenic
1196637917 X:118025100-118025122 ACTCCTGTTTTCACCCAACATGG + Intronic
1201957291 Y:19639318-19639340 ACTCCTGATCCTAACTATCAGGG - Intergenic