ID: 903099874

View in Genome Browser
Species Human (GRCh38)
Location 1:21019957-21019979
Sequence GAAAATAATTCCTCTACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903099872_903099874 23 Left 903099872 1:21019911-21019933 CCCATGAACATAATCAAGAAACA 0: 1
1: 0
2: 1
3: 27
4: 374
Right 903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG 0: 1
1: 0
2: 1
3: 17
4: 208
903099871_903099874 24 Left 903099871 1:21019910-21019932 CCCCATGAACATAATCAAGAAAC 0: 1
1: 0
2: 1
3: 25
4: 320
Right 903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG 0: 1
1: 0
2: 1
3: 17
4: 208
903099873_903099874 22 Left 903099873 1:21019912-21019934 CCATGAACATAATCAAGAAACAC 0: 1
1: 0
2: 2
3: 24
4: 252
Right 903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG 0: 1
1: 0
2: 1
3: 17
4: 208
903099870_903099874 25 Left 903099870 1:21019909-21019931 CCCCCATGAACATAATCAAGAAA 0: 1
1: 0
2: 2
3: 50
4: 807
Right 903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG 0: 1
1: 0
2: 1
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903099874 Original CRISPR GAAAATAATTCCTCTACTAC AGG Intronic
900916329 1:5641411-5641433 GAAAATAATTCTTCTTCTGGTGG - Intergenic
903010881 1:20329741-20329763 GAAAATCATTTCTCTAATCCAGG - Intronic
903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG + Intronic
904748839 1:32728181-32728203 TAAGATAATTGCTCTACTAGAGG + Intergenic
907209306 1:52805419-52805441 TTTAATAATTCCTCTATTACTGG - Intronic
907338548 1:53716795-53716817 AAATATAATTTCTCTACTGCCGG - Intronic
909237865 1:73176368-73176390 AAAAAGAAATCCTCTACTAATGG - Intergenic
909718911 1:78742798-78742820 GATAATAATTCCTGTACTTCTGG + Intergenic
916876324 1:168973384-168973406 GTGAACAATGCCTCTACTACTGG + Intergenic
918368576 1:183836068-183836090 GGGAATAATTCCTACACTACAGG + Intronic
920016642 1:202916246-202916268 GAAAATAATTCCTCTACAGTTGG + Intronic
921357765 1:214302681-214302703 CAAAATAATACCTCTACCAAAGG - Intronic
921433111 1:215085353-215085375 GAAAATAAAACACCTACTACAGG - Intronic
921503984 1:215943686-215943708 GAAAATTATCACTCTACTTCTGG - Intronic
922000206 1:221469719-221469741 GAAAAGAATTGCTCTGCCACAGG - Intergenic
924010078 1:239654976-239654998 AAAAATAATTCATCTGCTACTGG + Intronic
924372315 1:243364248-243364270 CAAAATAATTCCTCTTCCACTGG - Intronic
1063548798 10:7008264-7008286 GAAAATTATTCCTCTATGACTGG - Intergenic
1064324732 10:14339577-14339599 GAAAATAATTCCTCCGCTGGGGG - Intronic
1066063090 10:31741619-31741641 AAAAATGCTTCCTCTACCACTGG - Intergenic
1068664980 10:59664091-59664113 CAAAATAATTTCTTTACTTCTGG - Intronic
1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG + Intronic
1071972159 10:90918896-90918918 GACAAGAATTTTTCTACTACTGG + Exonic
1073313978 10:102565376-102565398 GTAATTGATTCCTCTACCACAGG - Intronic
1075186950 10:120270825-120270847 GATAATAATGCCTCTCCAACAGG + Intergenic
1079974573 11:27075872-27075894 GAAAAGAATTCCTCTTCTCCAGG + Intronic
1080389463 11:31831236-31831258 GAAAATAATACCTATTTTACAGG - Intronic
1080815448 11:35752120-35752142 GGGAATAATTCCTCGGCTACTGG - Intronic
1081350848 11:42050736-42050758 GATTATAATTCCTCTTTTACAGG + Intergenic
1081745983 11:45472929-45472951 GAAAATTATTCCCCCACTACAGG - Intergenic
1082241324 11:49874333-49874355 GAAAATATTACGTTTACTACAGG + Intergenic
1085905454 11:80755788-80755810 GAAAATAATACCTATATTGCAGG - Intergenic
1085927761 11:81041816-81041838 TAAATTAAATCCTCTACTTCTGG + Intergenic
1087958843 11:104323277-104323299 GAAAATCATTCCTGTATTTCTGG + Intergenic
1088736296 11:112730389-112730411 GAAAATAATTTTTCCACTAATGG - Intergenic
1092408984 12:8239941-8239963 GAAAAGAATTCCTGTGCTAGAGG - Intergenic
1096936130 12:55278970-55278992 GAAAATATTTCCTCCTCTTCAGG - Intergenic
1097327235 12:58290730-58290752 ATAAATAATTTCTCTACTTCAGG - Intergenic
1097693257 12:62753939-62753961 GAAAATAATACTTCTAATCCTGG - Intronic
1107368406 13:39712277-39712299 TAAAATAATTCATCTAAAACTGG - Intronic
1107745560 13:43503941-43503963 GAAAATAATTTATCTAATAAAGG + Intronic
1109094440 13:58095535-58095557 GAAAACACTTCCTCTCATACTGG - Intergenic
1109311459 13:60699255-60699277 AAAACTATTTCCTCTATTACTGG + Intergenic
1109847005 13:68006252-68006274 GAAATTAATTAATCTACTAGTGG + Intergenic
1109912408 13:68931928-68931950 GAATATAATACCTCTACCACAGG + Intergenic
1110704419 13:78588271-78588293 AAAAATAATTCTTCTATTAATGG - Intergenic
1113999257 14:16135350-16135372 GAAGATATTTCCTCTACAATAGG + Intergenic
1114348948 14:21828710-21828732 GAAAATAATTTTTCAACTAATGG + Intergenic
1115837847 14:37429342-37429364 TATAATAAATCCTATACTACTGG - Intronic
1116447138 14:45023075-45023097 GAAAGTAATTCCTTCACTCCAGG - Intronic
1116883912 14:50200013-50200035 GAAAAAAAATCCCCTAATACAGG - Intronic
1117556199 14:56887257-56887279 GAAAAAAATTCATTTACTAAGGG + Intergenic
1118244705 14:64098245-64098267 TTAAAAAATTCCTTTACTACAGG - Intronic
1119490017 14:75023760-75023782 GAAAATCATTTCTTTACTCCTGG + Intronic
1120650453 14:87125922-87125944 CAAAATTATTCCTTTACTAAAGG - Intergenic
1124463541 15:29915470-29915492 GAAAATCATTGCTCTGTTACTGG + Intronic
1124817823 15:33014127-33014149 GAAGCTAATGCCTTTACTACTGG + Intronic
1127442606 15:59025597-59025619 AAAAATAATACCTGTACTACAGG - Intronic
1127979180 15:64021764-64021786 GAAAATACTTCCTCTCCCTCTGG - Intronic
1129915809 15:79269690-79269712 GAAAATATTTCTTGTACTCCTGG + Intergenic
1132225063 15:100133955-100133977 TAAAATAATTCCACTAAAACAGG + Intronic
1133724068 16:8521196-8521218 GAAAATAATTCCTCCTTTTCTGG - Intergenic
1143077356 17:4355658-4355680 AAAAAAAATTCATTTACTACTGG + Intronic
1144801545 17:17931857-17931879 GAAAATAATTCTTATCATACAGG + Intronic
1145378329 17:22372339-22372361 CAAAGTAATTCCTCTACCATAGG + Intergenic
1145452265 17:23265584-23265606 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145460770 17:23389607-23389629 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145496250 17:23904998-23905020 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145513257 17:24152666-24152688 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145547340 17:24648529-24648551 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145569253 17:24967088-24967110 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145591591 17:25291622-25291644 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145676368 17:26524831-26524853 GAAGTTATTTCCTTTACTACGGG - Intergenic
1145686324 17:26670176-26670198 GAAGATATTTCCTTTTCTACTGG - Intergenic
1148071153 17:44909541-44909563 GAACAAAATTCCTCTTCTTCTGG - Intronic
1149294278 17:55247751-55247773 GAAAATAACTCCTCTGCCATAGG - Intergenic
1150015333 17:61551444-61551466 GAAAATAATTTCTGTACTTTGGG - Intergenic
1152158644 17:78652732-78652754 GGAAATAGTTCCTCTAAGACTGG + Intergenic
1153354082 18:4116701-4116723 AAAAATAATTTCTCTTTTACTGG + Intronic
1160381006 18:78455808-78455830 GAAAATAATTCTTCTGTGACTGG + Intergenic
1161634121 19:5376511-5376533 GACAATATTTCCTGTACTTCTGG + Intergenic
1163790517 19:19303406-19303428 GCAGGGAATTCCTCTACTACAGG - Exonic
1164063301 19:21693721-21693743 TAAAATTAATCCTCTCCTACTGG - Intergenic
1164178254 19:22796928-22796950 CTTAATAATTCCTATACTACTGG - Intergenic
1166189741 19:41168331-41168353 GTAAATCATTCCTATACAACTGG - Intergenic
1168543099 19:57229270-57229292 AAAAAAAATTCCTCAAGTACAGG + Intergenic
926519070 2:13886737-13886759 GAGAATAATTCCTGTTCTAAGGG - Intergenic
927272641 2:21229634-21229656 GAAAATAATACCTCCACTGCAGG - Intergenic
927438613 2:23092275-23092297 GAAAATAAATCCTCTTCCAAGGG + Intergenic
928748886 2:34448144-34448166 GAAAATAATTCATCTACCAGTGG + Intergenic
931245400 2:60488596-60488618 GAAAATACTTACTGTACTGCAGG + Intronic
932985304 2:76719358-76719380 GAAAATATTTTCTCTACAAAAGG - Intergenic
933076667 2:77937033-77937055 GAAAATATTTCCTCTGCACCAGG - Intergenic
933660240 2:84921543-84921565 GATAAGAATTCCTGTCCTACAGG - Intergenic
934382770 2:92931570-92931592 GAAGATAATTCCTTTATCACCGG - Intergenic
935862261 2:107345757-107345779 GAAAATTATTCTATTACTACTGG - Intergenic
937867404 2:126763188-126763210 GAAAATAATTGCTTTTCTGCAGG + Intergenic
938547054 2:132343874-132343896 GAAAACATTTCCTCTACGATGGG - Intergenic
939350552 2:141032455-141032477 GAAAATATTTCCCACACTACTGG - Intronic
940376931 2:152967909-152967931 GTAAGTAATTCCTCAACTATGGG + Intergenic
940943401 2:159588861-159588883 GAAATTATTTCCTCAAATACTGG + Intronic
943931022 2:193853671-193853693 TAAAATAATCCCTTTACTAGAGG + Intergenic
945635847 2:212349739-212349761 GAAAGCAATTGCTTTACTACGGG - Intronic
945849645 2:214990357-214990379 GAGAATAATTCCAATACTAGAGG + Intronic
947284685 2:228500515-228500537 GAAAGTAATTTCACTACTAAAGG - Intergenic
947343114 2:229160717-229160739 GAAAATGATTCCTTTAAAACGGG + Intronic
948219524 2:236258517-236258539 GAAAATGATTCCTCTAAGGCGGG + Intronic
1168900350 20:1358523-1358545 GACAATACTTGCTCTACTCCAGG - Intronic
1171524948 20:25801667-25801689 CAAAGTAATTCCTCTACCATAGG - Intronic
1171534132 20:25871332-25871354 AAAAGTAATACCTCTACAACAGG - Intergenic
1171551879 20:26054216-26054238 CAAAGTAATTCCTCTACCATAGG + Intergenic
1171735009 20:28769215-28769237 GAAGATATTTCCTCTACCATAGG + Intergenic
1171875917 20:30576611-30576633 GAAAACATTTCCTCTACGATGGG - Intergenic
1173336927 20:42119781-42119803 GAAACTCATTCCTCTCCTCCAGG + Intronic
1173948234 20:46968568-46968590 GAACATCATTCCTCTAAAACAGG + Intronic
1174983761 20:55426049-55426071 GAAAATAATGCCTCTCATGCAGG + Intergenic
1179120175 21:38537399-38537421 GAAAATAATTTATCTAATAAGGG + Intronic
1179969661 21:44827680-44827702 GAAAATAATTCCACCTCTAAGGG + Intergenic
1180573494 22:16751220-16751242 CAAAGTAATTTCTCTACTATAGG - Intergenic
1184183813 22:42850220-42850242 GGAAAAAATTCCTCTAATAGAGG + Intronic
1184985863 22:48133340-48133362 GAAAATAATTTTTGTACTAATGG + Intergenic
949555168 3:5146434-5146456 TTAATTAATTCCTCTATTACTGG + Intronic
949868505 3:8567207-8567229 TAAAAAAAATCCTCCACTACAGG - Intronic
951240990 3:20286157-20286179 GAAAAAAAATCCTCTCCTCCAGG + Intergenic
952531102 3:34262788-34262810 GAAAATGATTTCTCTACCCCAGG - Intergenic
953445204 3:42957782-42957804 GAAAATAGATCCTCCACTAGAGG + Intronic
957486493 3:80869495-80869517 GTAAATAATACATCTTCTACTGG - Intergenic
960412244 3:117341765-117341787 GAAAATAAACCTTCTCCTACTGG - Intergenic
960470608 3:118060511-118060533 AAAAATAATTCCTTCGCTACAGG - Intergenic
960812687 3:121640297-121640319 GGAAATATTGCCTCTACTTCTGG - Intronic
964988255 3:162771998-162772020 GAAAATAATTACTCCACTCTGGG + Intergenic
966642471 3:182206085-182206107 GAAGATAATTCCTGCCCTACAGG + Intergenic
967083820 3:186075981-186076003 GAAAAATATTCCTATAGTACTGG - Intronic
969097876 4:4747711-4747733 GAGAAAACTTCCTCTTCTACAGG - Intergenic
971901600 4:32666481-32666503 GAAAAGAATTCCAGTACTACAGG - Intergenic
972299954 4:37775736-37775758 GAAAATATTTACTCTATTAGGGG - Intergenic
972781034 4:42287106-42287128 GAAAGTAATTCCTTCACTCCAGG - Intergenic
973716641 4:53683330-53683352 GATAATAATTCCTCTACTTTTGG - Intronic
974769328 4:66390145-66390167 GAAAATAAGCCGTCTACTACAGG + Intergenic
974860632 4:67517082-67517104 AAAAATAATTAATCAACTACAGG + Intronic
974975893 4:68890581-68890603 GAAAATAATTCCACCACATCTGG - Intergenic
975443422 4:74437516-74437538 GTAAATAATACCTCAACTATGGG + Intergenic
975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977109026 4:92927176-92927198 GAAAATAATTGCTTTAGTGCTGG - Intronic
977126211 4:93171703-93171725 GAAAATAATTACTCTCATATAGG + Intronic
977348554 4:95849572-95849594 GAAACTCATGCCTATACTACAGG - Intergenic
979339043 4:119498779-119498801 GGAAATAAGTCCTCTCCCACAGG + Intronic
979729239 4:124003379-124003401 TTAAATAATTTCTCTATTACTGG - Intergenic
980002169 4:127502682-127502704 GAAAATAATTCCCATACTACAGG + Intergenic
980389638 4:132126320-132126342 GTAAATAACTCCTCTATGACTGG + Intergenic
980502236 4:133671805-133671827 TAAAATATTGCCTCTACTACAGG - Intergenic
981083351 4:140657394-140657416 GAAAATAAATCCTCAGCCACAGG + Intronic
981162592 4:141516640-141516662 TCAAATATTTCCTCTACTTCTGG + Intergenic
981629429 4:146801361-146801383 GAAATTAATTCTCATACTACTGG - Intronic
982736814 4:159015278-159015300 GAAAACAATTCCTTTACTGAAGG + Intronic
985616423 5:924951-924973 AAAAATAATTCATGTAATACAGG - Intergenic
987335280 5:16893335-16893357 GAAAATTATTTCTCTCCTGCTGG + Intronic
988440661 5:31228739-31228761 GAATCTAATGCCTCTAATACAGG + Intronic
992283507 5:75207507-75207529 TTTAATTATTCCTCTACTACTGG - Intronic
994704735 5:103188737-103188759 GATAATAATACCTCAAATACTGG - Intronic
996921205 5:128769753-128769775 GAAAAAAACTCTTCTTCTACTGG - Intronic
998491827 5:142553533-142553555 GAAAATAAATCATATAATACAGG + Intergenic
999085387 5:148883920-148883942 GCAAATAATTACTCTTCTTCAGG - Intergenic
999496611 5:152105379-152105401 GAATATAATTTTTCTACCACAGG + Intergenic
1001412932 5:171523700-171523722 GATAATAATTCCTCTTTTGCGGG + Intergenic
1004528196 6:16428908-16428930 CAAAATCCTTCCTCTACTTCAGG - Intronic
1005155470 6:22801085-22801107 GAAGTTAATTCTTCTATTACTGG + Intergenic
1012265323 6:97135098-97135120 GAAACTTATTCCACTAATACAGG - Intronic
1017182510 6:151566907-151566929 GAAAAAATTTCCTATACAACAGG - Intronic
1017346050 6:153382356-153382378 AACAATGATTTCTCTACTACTGG + Intergenic
1021694033 7:23259034-23259056 GGAAGTAATTCCTCTCCTTCAGG - Intronic
1023603274 7:41902083-41902105 GAAAATAATTACTCAATTTCTGG + Intergenic
1023925288 7:44664422-44664444 GACAAAAACTGCTCTACTACAGG - Intronic
1024119179 7:46220017-46220039 GAAAAGAATCCCTGTACTCCTGG - Intergenic
1024280303 7:47713164-47713186 TAAAATAACTCATCTAATACTGG + Intronic
1024987364 7:55206989-55207011 TAAAATAATTTCTCTACAATTGG + Exonic
1025100194 7:56128210-56128232 GAAAATATTACCTCTTCTGCCGG - Intergenic
1025300534 7:57816509-57816531 CAAAGTAATTCCTCTACCATAGG + Intergenic
1025415572 7:59808996-59809018 GAAGATATTTCCTTTTCTACTGG - Intergenic
1025460186 7:60602470-60602492 GAAGATATTTCCTTTTCTACTGG - Intergenic
1025463420 7:60660062-60660084 GAAGATATTTCCTTTTCTACTGG - Intergenic
1026305435 7:69136165-69136187 GAAATGATTTCCTCTACAACAGG - Intergenic
1027510737 7:79076627-79076649 GAAATTATTTCCTCTCATACAGG - Intronic
1028550337 7:92054640-92054662 GTAAATAACTCCTATAATACAGG - Intronic
1028659135 7:93248018-93248040 AAAAATAATTTGTCAACTACAGG - Intronic
1028832594 7:95343602-95343624 CAAGATAATCCCTCTGCTACAGG - Intergenic
1029943173 7:104502299-104502321 GAAATAAATTCCTCTTTTACTGG + Intronic
1030190203 7:106803115-106803137 GAAAATACTTCTTTTACTCCTGG + Intergenic
1030784100 7:113639380-113639402 GAAATACATTCCTCTACTTCAGG - Intergenic
1032442868 7:131955456-131955478 GAAAATAATTTCTATCCTCCGGG + Intergenic
1032447796 7:131999669-131999691 AAAGATAATTCCTCTCCTACTGG - Intergenic
1033343132 7:140507276-140507298 GAACATGACTCCTCTCCTACCGG - Intergenic
1033682451 7:143608199-143608221 GAAAAAAATTTCTCTTCTAGTGG + Intergenic
1033702438 7:143853714-143853736 GAAAAAAATTTCTCTTCTAGTGG - Exonic
1034227545 7:149495609-149495631 CAAAATAATTCCTCAACAAAAGG + Intronic
1034242719 7:149622649-149622671 CAAAATAATTCCTCAACAAAAGG + Intergenic
1035942714 8:3920995-3921017 GAAAATGTTTCCTCTTCTTCAGG + Intronic
1037126805 8:15361751-15361773 GAAAATTATTCTTTTAGTACAGG - Intergenic
1038924029 8:32117955-32117977 TAAATGAATTTCTCTACTACAGG - Intronic
1041037243 8:53806229-53806251 AAAAATAATATCTCTACCACTGG + Intronic
1042692290 8:71514282-71514304 GTAAAGAATTCCTGAACTACAGG - Intronic
1043127909 8:76423551-76423573 GGATATAATTCCTCTACTAAAGG - Intergenic
1043342032 8:79251470-79251492 GAGAATGATTGCTCTACTTCTGG - Intergenic
1045531135 8:102986532-102986554 ATAATTAATTCCTCTACAACTGG + Intergenic
1046383161 8:113475718-113475740 GTAAATAATACCTCAACTATGGG + Intergenic
1047109064 8:121768349-121768371 GAAAACATTCCTTCTACTACTGG + Intergenic
1050379389 9:5010880-5010902 AAAAATAATTCTCATACTACTGG - Intronic
1052596654 9:30569536-30569558 GAAATAAATTTCTCTTCTACTGG + Intergenic
1053115488 9:35497924-35497946 GAAAATTATACATGTACTACAGG + Intronic
1053326620 9:37158739-37158761 CAAAATAATTCTTCTACTGATGG - Intronic
1054471655 9:65543793-65543815 CAAAGTAATTTCTCTACCACAGG + Intergenic
1055528853 9:77162924-77162946 CATAATAATTCCTCTATTAATGG + Intergenic
1055724638 9:79214098-79214120 GAAAATATTTCCACTTCCACTGG - Intergenic
1056867190 9:90238639-90238661 GAAAATGATTCCACAGCTACCGG + Intergenic
1058522098 9:105821432-105821454 GATAATAATTCCACTATTGCAGG - Intergenic
1203381010 Un_KI270435v1:42177-42199 GAAGATAATTCCTTTTCCACTGG - Intergenic
1186219379 X:7333373-7333395 AAATATATCTCCTCTACTACTGG - Intronic
1186919910 X:14267381-14267403 GTAAAGATTTGCTCTACTACAGG - Intergenic
1187078038 X:15955540-15955562 TAAAATAACTTCTGTACTACTGG - Intergenic
1191693412 X:63963887-63963909 GATAATCATTCCACTACTTCTGG - Intergenic
1192725264 X:73744001-73744023 GAAAATATTTTCTCTATTTCTGG + Intergenic
1193179145 X:78433071-78433093 CAAAATAATACATCTCCTACTGG - Intergenic
1193286620 X:79722260-79722282 TGAGATAATTCCTTTACTACAGG - Intergenic
1193686739 X:84585903-84585925 GAAAATATTTGCTCTAGTATTGG + Intergenic
1194582680 X:95696313-95696335 GAAAAAAATGACTCTACTCCAGG - Intergenic
1194850345 X:98861113-98861135 GAAAAAAAACCCTTTACTACAGG - Intergenic