ID: 903104319

View in Genome Browser
Species Human (GRCh38)
Location 1:21062149-21062171
Sequence CGAGAGGATTGCTTGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214691
Summary {0: 112, 1: 2344, 2: 18419, 3: 54972, 4: 138844}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104319_903104324 26 Left 903104319 1:21062149-21062171 CCAGGGCTCAAGCAATCCTCTCG 0: 112
1: 2344
2: 18419
3: 54972
4: 138844
Right 903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG 0: 1
1: 10
2: 92
3: 800
4: 2789
903104319_903104325 27 Left 903104319 1:21062149-21062171 CCAGGGCTCAAGCAATCCTCTCG 0: 112
1: 2344
2: 18419
3: 54972
4: 138844
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903104319 Original CRISPR CGAGAGGATTGCTTGAGCCC TGG (reversed) Intronic
Too many off-targets to display for this crispr