ID: 903104320

View in Genome Browser
Species Human (GRCh38)
Location 1:21062165-21062187
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39282
Summary {0: 1, 1: 27, 2: 732, 3: 6876, 4: 31646}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104320_903104324 10 Left 903104320 1:21062165-21062187 CCTCTCGTTTCAGCCTCCCAAGT 0: 1
1: 27
2: 732
3: 6876
4: 31646
Right 903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG 0: 1
1: 10
2: 92
3: 800
4: 2789
903104320_903104325 11 Left 903104320 1:21062165-21062187 CCTCTCGTTTCAGCCTCCCAAGT 0: 1
1: 27
2: 732
3: 6876
4: 31646
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903104320 Original CRISPR ACTTGGGAGGCTGAAACGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr