ID: 903104321

View in Genome Browser
Species Human (GRCh38)
Location 1:21062178-21062200
Sequence TGTAGTTTTAACTACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90785
Summary {0: 1, 1: 51, 2: 1042, 3: 11790, 4: 77901}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104321_903104328 28 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104328 1:21062229-21062251 GTTTTATTTTTTGGTGAGACAGG 0: 1
1: 6
2: 150
3: 3079
4: 41599
903104321_903104329 29 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104329 1:21062230-21062252 TTTTATTTTTTGGTGAGACAGGG 0: 4
1: 74
2: 2019
3: 28708
4: 126396
903104321_903104324 -3 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG 0: 1
1: 10
2: 92
3: 800
4: 2789
903104321_903104325 -2 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104321_903104327 19 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104327 1:21062220-21062242 GGCTAATTTGTTTTATTTTTTGG 0: 1
1: 15
2: 478
3: 826
4: 2325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903104321 Original CRISPR TGTAGTTTTAACTACTTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr