ID: 903104322

View in Genome Browser
Species Human (GRCh38)
Location 1:21062181-21062203
Sequence ACATGTAGTTTTAACTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7672
Summary {0: 1, 1: 0, 2: 31, 3: 664, 4: 6976}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104322_903104324 -6 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG 0: 1
1: 10
2: 92
3: 800
4: 2789
903104322_903104328 25 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104328 1:21062229-21062251 GTTTTATTTTTTGGTGAGACAGG 0: 1
1: 6
2: 150
3: 3079
4: 41599
903104322_903104329 26 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104329 1:21062230-21062252 TTTTATTTTTTGGTGAGACAGGG 0: 4
1: 74
2: 2019
3: 28708
4: 126396
903104322_903104327 16 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104327 1:21062220-21062242 GGCTAATTTGTTTTATTTTTTGG 0: 1
1: 15
2: 478
3: 826
4: 2325
903104322_903104325 -5 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903104322 Original CRISPR ACATGTAGTTTTAACTACTT GGG (reversed) Intronic
Too many off-targets to display for this crispr