ID: 903104323

View in Genome Browser
Species Human (GRCh38)
Location 1:21062182-21062204
Sequence CACATGTAGTTTTAACTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8804
Summary {0: 1, 1: 0, 2: 38, 3: 692, 4: 8073}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104323_903104324 -7 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104324 1:21062198-21062220 ACATGTGTGTGCCACTACACTGG 0: 1
1: 10
2: 92
3: 800
4: 2789
903104323_903104325 -6 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104323_903104329 25 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104329 1:21062230-21062252 TTTTATTTTTTGGTGAGACAGGG 0: 4
1: 74
2: 2019
3: 28708
4: 126396
903104323_903104328 24 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104328 1:21062229-21062251 GTTTTATTTTTTGGTGAGACAGG 0: 1
1: 6
2: 150
3: 3079
4: 41599
903104323_903104327 15 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104327 1:21062220-21062242 GGCTAATTTGTTTTATTTTTTGG 0: 1
1: 15
2: 478
3: 826
4: 2325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903104323 Original CRISPR CACATGTAGTTTTAACTACT TGG (reversed) Intronic