ID: 903104325

View in Genome Browser
Species Human (GRCh38)
Location 1:21062199-21062221
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28813
Summary {0: 1, 1: 20, 2: 385, 3: 4073, 4: 24334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903104322_903104325 -5 Left 903104322 1:21062181-21062203 CCCAAGTAGTTAAAACTACATGT 0: 1
1: 0
2: 31
3: 664
4: 6976
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104323_903104325 -6 Left 903104323 1:21062182-21062204 CCAAGTAGTTAAAACTACATGTG 0: 1
1: 0
2: 38
3: 692
4: 8073
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104320_903104325 11 Left 903104320 1:21062165-21062187 CCTCTCGTTTCAGCCTCCCAAGT 0: 1
1: 27
2: 732
3: 6876
4: 31646
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104319_903104325 27 Left 903104319 1:21062149-21062171 CCAGGGCTCAAGCAATCCTCTCG 0: 112
1: 2344
2: 18419
3: 54972
4: 138844
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334
903104321_903104325 -2 Left 903104321 1:21062178-21062200 CCTCCCAAGTAGTTAAAACTACA 0: 1
1: 51
2: 1042
3: 11790
4: 77901
Right 903104325 1:21062199-21062221 CATGTGTGTGCCACTACACTGGG 0: 1
1: 20
2: 385
3: 4073
4: 24334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type