ID: 903105187

View in Genome Browser
Species Human (GRCh38)
Location 1:21072160-21072182
Sequence CTTTTCTAAGGTAATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903105184_903105187 24 Left 903105184 1:21072113-21072135 CCTAAGTTTTGTATCATGTACAT 0: 1
1: 1
2: 0
3: 21
4: 246
Right 903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG 0: 1
1: 0
2: 3
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903105187 Original CRISPR CTTTTCTAAGGTAATAAAGT TGG Intronic
901153654 1:7121575-7121597 CTTTTCTCAGATAATTCAGTAGG + Intronic
902746793 1:18480073-18480095 CTTGCCTAAGGTCATATAGTTGG + Intergenic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
905002929 1:34687548-34687570 CTTTTCTCAGGTAAAAACCTAGG + Intergenic
906907239 1:49909070-49909092 CTTTTCCAAGGTCAAACAGTTGG - Intronic
907550299 1:55299314-55299336 CTCATCTAAGGGAATGAAGTTGG - Intergenic
907807247 1:57833189-57833211 CTTTTCTAAAGAAAAATAGTAGG - Intronic
907822239 1:57982092-57982114 CATTTTTCAGGTAATAAGGTAGG + Intronic
909425877 1:75523930-75523952 CTTCTCCAAGGGAATAAAGTAGG + Intronic
910167991 1:84348231-84348253 CTTGCCTAAGGTCACAAAGTGGG + Intronic
910489408 1:87752206-87752228 CTTGTCTAAGGTATCATAGTAGG + Intergenic
910982049 1:92967871-92967893 CTTTTTTTAGGTAAGAAAGGGGG - Intergenic
911588413 1:99717859-99717881 CTCTTCTGAGGTTACAAAGTTGG + Intronic
912747800 1:112260122-112260144 CTTGTCTAAGGTCACAAGGTGGG + Intergenic
915401404 1:155624660-155624682 CTTTGATAAGGAAAGAAAGTAGG + Intergenic
916457333 1:164984371-164984393 CTTTTGTAAGGTAATAAATGTGG + Intergenic
916726990 1:167532392-167532414 TTTTTCTAAGGTCACAAAGCTGG + Intronic
917347169 1:174040211-174040233 TTTTTCTAAGGTAATCAAGGAGG - Intergenic
917689625 1:177455073-177455095 CTTTTCTAAGTTTTTAAGGTGGG + Intergenic
919733481 1:200929445-200929467 CTTTTCTTAGGGAACAAATTTGG + Intergenic
920287390 1:204890407-204890429 CTTTTATAAGTAAATAAAGTGGG + Intronic
921650338 1:217671093-217671115 CTTGTCATAGGTAAAAAAGTGGG - Intronic
922965496 1:229687684-229687706 CTTTTCTAAAGTAAAGAAGATGG - Intergenic
924206906 1:241721607-241721629 CTTTTGTGAGATAAGAAAGTTGG + Intronic
1063128487 10:3156917-3156939 GTATTTTAAGGTAAGAAAGTTGG - Exonic
1063794799 10:9501386-9501408 TTTTTCCAAAGTAAAAAAGTGGG - Intergenic
1066176171 10:32909086-32909108 CTTTTGTAAAAGAATAAAGTTGG + Intronic
1066240698 10:33531767-33531789 CTTTTCAAGGGAAAAAAAGTGGG + Intergenic
1066705839 10:38176457-38176479 CTGTTCAAAGATAAGAAAGTTGG + Intergenic
1067219021 10:44328932-44328954 ATTTTCTAAACTAATAAATTAGG - Intergenic
1067991364 10:51216451-51216473 CTTGTTTAAGGTCATAAAGATGG - Intronic
1068320456 10:55407216-55407238 TTTTTCTAAGTTAAAAAAGGAGG - Intronic
1069124455 10:64612659-64612681 CTTTTTTAAGGCAGTAAAATTGG - Intergenic
1069302088 10:66920834-66920856 CTTTTCTAAGGAAATAGAAGTGG - Intronic
1069336703 10:67359905-67359927 CTTTTCTAAGTCAACAAAGAAGG + Intronic
1071691049 10:87819673-87819695 CTTTTCTAAGTTCATATACTTGG + Intronic
1074155527 10:110795595-110795617 CTCTGCTAAGGTAATACAGGGGG - Intronic
1074230988 10:111534999-111535021 CTTTCCCAAGGTCATAAAGCGGG - Intergenic
1074937554 10:118199863-118199885 CTTTTCCAAGGTGAAAAATTAGG + Intergenic
1078082022 11:8211074-8211096 CTTTTCTAAGAAAAGAGAGTAGG + Intergenic
1079575153 11:21994977-21994999 CTTATCCAAGGGTATAAAGTGGG - Intergenic
1079745183 11:24118092-24118114 CTTTTCAAAAAAAATAAAGTTGG + Intergenic
1079944798 11:26728625-26728647 CTTGTTCAAGGTGATAAAGTTGG - Intergenic
1080161892 11:29186178-29186200 ATTTTGTAGGGCAATAAAGTTGG + Intergenic
1081033040 11:38111006-38111028 CTTTGCTAAGGTAATGCAGAGGG + Intergenic
1081516575 11:43837263-43837285 CTTTTTTAAGCTAAAAAAATAGG + Intronic
1082205288 11:49426115-49426137 CTTTTCTAAGGAAATTAAATTGG - Intergenic
1082225705 11:49704305-49704327 CTTTCCTAAAGTAACAAGGTTGG - Intergenic
1082999132 11:59275693-59275715 CTTTTGTTAGGGAATGAAGTGGG - Intergenic
1083027062 11:59559924-59559946 CTTTCCTAAGGTAGTAAGGAGGG + Intergenic
1085671660 11:78471126-78471148 AATTTCTAAGGTAATAATGGTGG + Intronic
1086649815 11:89274421-89274443 CTTTTCTAAGGAAATTAAATTGG + Intronic
1087183802 11:95164212-95164234 CTTTACTAGTGTAAGAAAGTTGG - Intergenic
1087435227 11:98108114-98108136 CTTTTCTCAGCTAAAAAATTAGG - Intergenic
1087864873 11:103212706-103212728 CTTTGTTAGGGTAGTAAAGTAGG + Intronic
1088032956 11:105274636-105274658 ATTTCCTATGGGAATAAAGTTGG + Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090934806 11:131331858-131331880 CTTTTCTAAATTTATAAATTTGG + Intergenic
1093071713 12:14712423-14712445 CTTTTCTAATATAATAAAATTGG - Intergenic
1093791962 12:23262437-23262459 CTTTTCTAACTTAATTAACTTGG + Intergenic
1094750083 12:33396515-33396537 AATTTCTAAGGTAAGAAACTGGG + Intronic
1099449904 12:82795997-82796019 CTTTTCAGAGGTAATAAGATGGG + Intronic
1100175726 12:92028889-92028911 CTGTTCTAAGGTAAAGAACTTGG - Intronic
1101605474 12:106245507-106245529 CTTTTCTAAGGGAATTAAGTAGG - Intronic
1102391771 12:112554879-112554901 CTTTTCTGAGGTCACACAGTAGG + Intergenic
1108889621 13:55238610-55238632 CTTTTCTAAGCCAGTAAATTTGG - Intergenic
1109000037 13:56788818-56788840 CTTTACAAAGGTAAGAAATTAGG - Intergenic
1109138113 13:58678821-58678843 CTTTTCCAAGCTAATAATGTTGG + Intergenic
1110072172 13:71191003-71191025 CTATTCTATGGCATTAAAGTTGG - Intergenic
1110316313 13:74112055-74112077 CTGTTCTATGGTAATAAGTTGGG - Intronic
1112301679 13:98236441-98236463 CATTTCTAAAATAATACAGTTGG + Intronic
1112826002 13:103393223-103393245 TTTTTCTAAGGTCAGAAAGTAGG - Intergenic
1112925386 13:104667899-104667921 CTTTTCTAAGAGAAAACAGTAGG - Intergenic
1113214743 13:108026549-108026571 GTTTTCTAAGGCTAAAAAGTAGG - Intergenic
1113514415 13:110881748-110881770 TTTTACTAAGAGAATAAAGTAGG + Intronic
1115136103 14:30109788-30109810 CTCTTCTAAGGAAATAAACTGGG - Intronic
1116191137 14:41668409-41668431 ATTGTCCAAGGTTATAAAGTAGG - Intronic
1116832474 14:49735683-49735705 CTTTTCAAAGCCAAAAAAGTAGG - Intronic
1117344455 14:54818616-54818638 CTTTTTTAAGGTCAGAAAGTGGG - Intergenic
1117428715 14:55629528-55629550 CTTTCCTAAGGGAAAAAAATAGG - Intronic
1118010240 14:61603462-61603484 CTTATCTAAGGTCACAAAGGTGG - Intronic
1118049301 14:62009455-62009477 CTTTTCTAAGAATATAAAATTGG + Intronic
1118370302 14:65131964-65131986 CTTTTCTAAGGTAAGAGTCTAGG + Intergenic
1120059918 14:79970426-79970448 CTTAGCTAAGATAATTAAGTTGG + Intergenic
1120635461 14:86944983-86945005 TTTTTCTAAGGCAATTCAGTTGG - Intergenic
1122332021 14:100925916-100925938 TTGTTCTAAGGGAATAAAGGAGG + Intergenic
1124857194 15:33400650-33400672 ATTTTGTAAGGTAGTAGAGTAGG + Intronic
1124988533 15:34647403-34647425 CTTTTCCAAGGTCACAAAGTTGG + Intergenic
1126983969 15:54281290-54281312 CTTTTCTGAAATAAGAAAGTTGG + Intronic
1128915576 15:71558381-71558403 CTGTTCTAATGTATTAAAGATGG + Intronic
1131163117 15:90122181-90122203 CTTTTCTCAGGTCAATAAGTTGG - Intergenic
1134185168 16:12079325-12079347 CTTTTTCTAGGTAGTAAAGTTGG - Intronic
1137316786 16:47333619-47333641 CTTTTATAAGTTCATGAAGTTGG + Intronic
1137517226 16:49156976-49156998 TTTTTCTAAGTTAGCAAAGTTGG - Intergenic
1137678681 16:50319045-50319067 CTTGTATTAGGTAATAAAGCTGG - Exonic
1137825143 16:51487963-51487985 TTTTTCTAGGTTATTAAAGTGGG + Intergenic
1138049096 16:53757602-53757624 CTTTTCTTAGATAATATACTTGG - Intronic
1138771261 16:59666801-59666823 ATTTTCCAAAGTAATAAAATGGG + Intergenic
1140239356 16:73187319-73187341 CTTTTCTCAGATAGTAAAGAGGG + Intergenic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1143806444 17:9431675-9431697 CTTTTCTCAGTTAGTAAAATTGG - Intronic
1144052330 17:11507645-11507667 CTCTTCTCAAGTAATAATGTTGG - Intronic
1144785687 17:17830483-17830505 CTTGTCCAAGGTCATACAGTAGG + Intronic
1147273934 17:39299117-39299139 CTTTTCTAAAGTAATGAGGTGGG - Intronic
1148552602 17:48559517-48559539 CTTTTCTAGGGCTACAAAGTTGG - Intronic
1149432713 17:56607174-56607196 CTTGTCTAAAGTAACAAAGCTGG + Intergenic
1151045689 17:70917401-70917423 CTTTACTAGGGTAGTAAAGAGGG + Intergenic
1151094577 17:71481645-71481667 CATTGCCAAGTTAATAAAGTAGG - Intergenic
1151142827 17:72011292-72011314 CTTTTCTAAGGTCATATAGTTGG + Intergenic
1151264735 17:72945969-72945991 CTTCTCTAGGGTATAAAAGTTGG - Intronic
1152973342 18:187147-187169 CATTTCTAAGGTAAAAATCTAGG + Intronic
1154508219 18:15063910-15063932 TTTTTCTCAGGTAATAGATTAGG + Intergenic
1154937110 18:21072330-21072352 CTTTATTAGGGAAATAAAGTTGG + Intronic
1154996402 18:21644580-21644602 CTTTTCTTGGGTAAGAAATTTGG - Intergenic
1157836107 18:50904716-50904738 CTTCTCTAAAGAAATAATGTCGG - Intronic
1158381653 18:56937214-56937236 CTTTTTAAAGGTAATAAATGTGG - Intronic
1159375946 18:67593449-67593471 CTTATATTAGGTAATAAATTTGG - Intergenic
1161020205 19:2006537-2006559 TCTTTCTAAGGACATAAAGTTGG - Intronic
1163764672 19:19156256-19156278 CATTAAAAAGGTAATAAAGTGGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164703064 19:30299828-30299850 CATTTTTAAGGTAATAAAAATGG - Intronic
926991256 2:18682923-18682945 ATTTGCTAAGCTAATAAAGAGGG + Intergenic
927014155 2:18939212-18939234 TTTTTCAAAGATAAAAAAGTTGG - Intergenic
927623264 2:24684844-24684866 CTTTTCTAAGTTAGTGTAGTTGG - Intronic
928210930 2:29323075-29323097 CTTTTGTAAGGTCACAAAGCAGG - Intronic
928586536 2:32764434-32764456 TTTTTTTTTGGTAATAAAGTAGG - Intronic
928826068 2:35422577-35422599 CTTATTTAAGGTAATTCAGTGGG + Intergenic
929645437 2:43622107-43622129 TTTGTCTAAGGTTTTAAAGTTGG + Intergenic
929825150 2:45304331-45304353 CTTTTCTTGGGAAAGAAAGTGGG - Intergenic
930133096 2:47873036-47873058 CTATTGTAGAGTAATAAAGTAGG + Intronic
931444356 2:62314396-62314418 CTTGTCTAAGGTGATAGACTTGG + Intergenic
931683390 2:64771210-64771232 CTTGTCTAAGGTCACAGAGTGGG - Intergenic
932078867 2:68692857-68692879 CTTTACTCAGCTACTAAAGTTGG + Intronic
933830094 2:86199757-86199779 CTTTTCTAGGGAAAAAAAGCTGG - Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934512370 2:94955691-94955713 CTTTTCTAAATTTATAAATTGGG - Intergenic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
939322828 2:140646476-140646498 CTTTTCTAAGATAACACACTTGG + Intronic
940184184 2:150964313-150964335 CTATTCATAGGTAATAAAATGGG - Intergenic
942007897 2:171725766-171725788 CTTTTATTATGTATTAAAGTAGG + Intronic
942477138 2:176339351-176339373 CTTGTCCAAGGTCATAAAGTTGG + Intergenic
943151653 2:184121605-184121627 ATTTTCTAGGGTATTAAAGAGGG + Intergenic
945030527 2:205659121-205659143 TTTTTCAAAGGGAATATAGTTGG + Intergenic
946105058 2:217361869-217361891 TTTTGTTAAGGTAATAAGGTGGG - Intronic
946730066 2:222700956-222700978 CTTACTTAAGTTAATAAAGTAGG - Intronic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
1168985233 20:2042495-2042517 CTCTTCTGAGGTCCTAAAGTCGG - Intergenic
1171458436 20:25284979-25285001 ATTTTGTAATTTAATAAAGTAGG + Intronic
1173829951 20:46076519-46076541 TTTTTTTAAGGTAAAAAACTGGG + Intronic
1173829954 20:46076574-46076596 TTTTTTTAAGGTAAAAAACTGGG + Intronic
1174740311 20:53006888-53006910 CTTTTCTGAGTTAATTGAGTAGG + Intronic
1176519051 21:7811494-7811516 CTTTTCTAGGAAAATTAAGTGGG - Intergenic
1176789863 21:13307878-13307900 TTTTTCTCAGGTAATAGATTAGG - Intergenic
1177050116 21:16222940-16222962 CATTTCTAAGTGAATCAAGTTGG + Intergenic
1177232653 21:18342531-18342553 CTTTTCTAAAGTAATATAATTGG - Intronic
1177804196 21:25857691-25857713 CTTTTCTAAAAGAACAAAGTTGG - Intergenic
1177866745 21:26521214-26521236 CTTTTAAAAGAGAATAAAGTAGG + Intronic
1178247413 21:30967356-30967378 CTTTTGGAAGGTAATTAAGGTGG - Intergenic
1178653079 21:34441507-34441529 CTTTTCTAGGAAAATTAAGTGGG - Intergenic
1180568207 22:16693111-16693133 ATTTTCTAAGATAAGAAAGACGG + Intergenic
1182250779 22:28998395-28998417 CTTTTCTAAGGTGAGCAAGATGG + Intronic
949772968 3:7598595-7598617 CCTTTATAAGAAAATAAAGTAGG + Intronic
950087899 3:10273583-10273605 TTTTTTTAATGTAATAAAGATGG - Intronic
950245530 3:11413766-11413788 CTTTTCTAAAGAATTAAAGATGG - Intronic
951221609 3:20074949-20074971 ATTTTCTAAAGTAATAAAATGGG - Intronic
954146539 3:48637182-48637204 CCTTTTTAAGGGAATAAAGGAGG + Exonic
956398985 3:68856331-68856353 CATTTTTAAATTAATAAAGTAGG + Intronic
957452441 3:80397305-80397327 CTTATCAAATGTAATAATGTAGG + Intergenic
958650057 3:96926966-96926988 CTTTGCTAGGGTAGTACAGTAGG - Intronic
958785768 3:98594521-98594543 TTTTTCTAAAATAATCAAGTAGG - Intergenic
960350807 3:116590392-116590414 CATTTCTAAGGTAATTCATTTGG + Intronic
962109518 3:132429407-132429429 CTTTTCTAAGGTAACACAGCTGG - Intronic
962622642 3:137195148-137195170 CTTGTCCAATGTAATACAGTTGG - Intergenic
962729799 3:138270708-138270730 CTTGTCGAAGGTAATAAAATTGG + Intronic
962936413 3:140085178-140085200 CTTTTCTAAGGCAGGAAATTAGG - Intronic
963341988 3:144047440-144047462 ATTTTGTAAGGTAATGAATTTGG + Intronic
964463340 3:156961814-156961836 CTATTCTAATGTATTAAGGTAGG - Intronic
964713809 3:159700069-159700091 CTTTTCTACCTTAATAAAATGGG + Intronic
964741986 3:159975873-159975895 CTTTCCTAAGATAGTAAAGCTGG - Intergenic
965727866 3:171738359-171738381 CTTATCCAAGTTAATAAAGTTGG - Intronic
966980095 3:185124912-185124934 CTTCTCTAACGTAATGATGTTGG - Intronic
970340545 4:15101983-15102005 CATTTCTAAGGTCACAAAGCTGG + Intergenic
971724010 4:30284644-30284666 CTTTTTTAAGGGAATAATTTAGG - Intergenic
971955262 4:33409565-33409587 CTTTTTTCAGGTAATATAATTGG - Intergenic
972491444 4:39591273-39591295 CTTTCCTAATCTAATACAGTTGG - Intronic
973964098 4:56143223-56143245 CTTTTCTAACTTGTTAAAGTGGG + Intergenic
974102333 4:57430792-57430814 CTTTTCCAAGGTCACACAGTTGG + Intergenic
974893486 4:67909406-67909428 CATTTTTAATCTAATAAAGTTGG - Intronic
975550710 4:75609837-75609859 GATATCTAGGGTAATAAAGTTGG - Intronic
975868845 4:78755750-78755772 ATTTTTTAATGTAATAAAGTAGG - Intergenic
976479460 4:85523150-85523172 CTTTTGTCAGATAATAAAGAAGG + Intronic
976633821 4:87267177-87267199 TTTTTCTAGTGTAACAAAGTGGG - Intergenic
976763836 4:88578817-88578839 CTTGTCTAAGATCATATAGTGGG + Intronic
977327801 4:95598410-95598432 GTTTTATAAGGAATTAAAGTAGG + Intergenic
977363085 4:96031449-96031471 CTTTTCCAAGGTAATACATTTGG + Intergenic
977957189 4:103043239-103043261 CTTTTCTAATGAGATTAAGTTGG - Intronic
978037732 4:104016789-104016811 CTTTTCTAAGGTAAACCATTAGG + Intergenic
979037051 4:115734080-115734102 CTTTTCTTAAGTAAAAGAGTGGG + Intergenic
979309763 4:119189201-119189223 CTTTTCTAAGGAGAAAGAGTGGG + Intergenic
980343872 4:131586281-131586303 CTATTCCAAGGTAATTAATTTGG - Intergenic
980729252 4:136805587-136805609 GTTTTCTAATGTAAAAAACTGGG - Intergenic
981724908 4:147837081-147837103 CTTATGTCAGGTATTAAAGTGGG + Intronic
983713961 4:170754631-170754653 CTTTGCTAAGGTAGTGAAGAAGG + Intergenic
983866513 4:172773492-172773514 CTTTACTAAGGTCATAAATAAGG - Intronic
984117221 4:175696290-175696312 CTTTTCCAAGGTAAGAAAGCTGG + Intronic
986266111 5:6192585-6192607 CTTTTAAAAGTTAATAAATTTGG + Intergenic
987664572 5:20920475-20920497 CTTTTCTAAGATTATAATTTAGG - Intergenic
987801988 5:22710158-22710180 CTGTACTTAGGAAATAAAGTTGG - Intronic
987901678 5:24020343-24020365 TTTTTCTAAGCTAATAAGATTGG - Intronic
987960404 5:24800473-24800495 CTTTTGTAATGTGATAAAATAGG + Intergenic
988758112 5:34281706-34281728 CTTTTCTAAGATTATAATTTAGG + Intergenic
990093219 5:52081807-52081829 CTCCTTGAAGGTAATAAAGTAGG + Intergenic
991705843 5:69357845-69357867 ATTTTATAAAGTTATAAAGTTGG - Intronic
994359270 5:98831724-98831746 CTTTTCTCAGGTAATGAGCTGGG + Intergenic
994916833 5:105991640-105991662 ATTTTTTAAGCTATTAAAGTTGG + Intergenic
996808656 5:127488587-127488609 CTTATCCAAGGTCATAAACTAGG + Intergenic
998672174 5:144366476-144366498 CTTTTCTAAGATAGTGAATTGGG + Intronic
998742987 5:145226109-145226131 CTTTTCTTAGGTAAAAAATTGGG + Intergenic
999763242 5:154719022-154719044 CTTCTCTGAGCTAATACAGTGGG - Intronic
1000292140 5:159880398-159880420 CTTTTCAAAGGTGATAAAACAGG + Intergenic
1000761831 5:165235615-165235637 CTTGTCTTTTGTAATAAAGTTGG - Intergenic
1001139401 5:169131643-169131665 CTTTTCCAAGCTGAAAAAGTAGG - Intronic
1001261306 5:170232072-170232094 CTTTTCTAAGATCATACAGCTGG + Intergenic
1003205307 6:4004081-4004103 CTTTTCCAAAGGTATAAAGTAGG - Intergenic
1003575425 6:7289670-7289692 TTTTTCTAAAGTAACAAATTTGG - Exonic
1003792410 6:9561613-9561635 CTTTTCTATGGTAACAAAACTGG - Intergenic
1004992490 6:21154305-21154327 CCATTCTAAGGAAACAAAGTTGG + Intronic
1005307295 6:24525952-24525974 CTTTTCTGAAGAAATATAGTAGG + Intronic
1008196842 6:48534758-48534780 CTTTTCTAAAAGAATAAATTAGG + Intergenic
1010107548 6:72187406-72187428 TTTCCCTGAGGTAATAAAGTAGG + Intronic
1010527463 6:76921463-76921485 CTTTTATAATTTAAAAAAGTTGG - Intergenic
1010986113 6:82426384-82426406 CATTTCTGAGTTGATAAAGTTGG + Intergenic
1011118740 6:83926575-83926597 CATTTAAAAGGTAATTAAGTTGG - Intronic
1012061265 6:94485282-94485304 CTGTCCTAAGGAAATAAACTAGG + Intergenic
1012273006 6:97237881-97237903 TGTTTATAAGGTAAAAAAGTAGG + Intronic
1012626121 6:101404967-101404989 ATTTTGTAAGGTAATTAAATTGG + Intronic
1012632981 6:101496615-101496637 CCTTTTTAAAGTAATAAGGTTGG + Intronic
1013571590 6:111431927-111431949 CTTGTATTAGGTAATAAAGCGGG + Intronic
1014533833 6:122593619-122593641 CTTTTCAAAGGCAATATAGATGG + Intronic
1015909131 6:138149025-138149047 CTTGACAAAGATAATAAAGTTGG - Intergenic
1017365968 6:153638279-153638301 CTTTTCTAATGTATTGAACTTGG + Intergenic
1020495127 7:8841731-8841753 TATTTCTAAGGTGATAAAATTGG - Intergenic
1021467658 7:20963734-20963756 CTTCTCTAAGATAATGAAATAGG + Intergenic
1021731742 7:23601993-23602015 CTTTTCTCTGGAAATAATGTTGG + Intronic
1022832803 7:34085420-34085442 TTTTCCTAAGGTAATCATGTTGG - Intronic
1025613414 7:63097654-63097676 CTTTTTTAAGGTCAGAAAGTGGG + Intergenic
1027533295 7:79363513-79363535 ATTTTCAAAATTAATAAAGTGGG + Intronic
1027798071 7:82718639-82718661 CTTTTGTAAGATAATTAACTAGG - Intergenic
1028397417 7:90386504-90386526 CTTTACTAAAATAAGAAAGTGGG - Exonic
1028747594 7:94345690-94345712 GTCTTCAAAGGTAATAAAGTTGG + Intergenic
1031340084 7:120589152-120589174 TCTTTCTAAGGTTAGAAAGTAGG + Intronic
1031469314 7:122150161-122150183 CTTTTCTCAGGAAATAAAAGAGG + Intergenic
1035827052 8:2656082-2656104 CTTTTCTATGCTGATGAAGTCGG + Intergenic
1036471170 8:9054113-9054135 CTTTTCCATGGTAAAAGAGTTGG - Intronic
1037237512 8:16738657-16738679 CTTTTCTGATTGAATAAAGTAGG - Intergenic
1037271565 8:17136237-17136259 ATTTTTAAAGGAAATAAAGTAGG + Intergenic
1042372581 8:68008570-68008592 CGTTTCTGAGGTATAAAAGTTGG + Intronic
1042580477 8:70272470-70272492 CTTATCAAAGGAAAAAAAGTTGG - Intronic
1043414110 8:80030751-80030773 CTTTTCAAAGTTTAAAAAGTTGG - Intronic
1044237428 8:89847227-89847249 CTTTTCTAAGGTTACACAGCTGG - Intergenic
1046706722 8:117461724-117461746 CTTTCCTCAGGAAATAAACTTGG - Intergenic
1046929705 8:119829812-119829834 CTTTCTTAAGGGCATAAAGTTGG - Intronic
1047993699 8:130313400-130313422 CCTTTCTAAGGTAAGAGATTTGG - Intronic
1048185832 8:132239997-132240019 CATTTCCAGGGTAATAAAATAGG - Intronic
1050292388 9:4168638-4168660 CTTTTTTAAAGTAAAAATGTTGG - Intronic
1050343590 9:4664264-4664286 CTCTTTCAGGGTAATAAAGTGGG + Exonic
1050455905 9:5833710-5833732 CGTTTCTCAGGTTATAAAATGGG - Intergenic
1051410008 9:16779879-16779901 CTTTTCTGAGGTAATAAAAACGG + Intronic
1052327623 9:27232704-27232726 CTTTTCTAAGGTTCTCCAGTGGG - Intergenic
1054707221 9:68474935-68474957 CTTTTCTAGAGTCATATAGTTGG - Intronic
1055014887 9:71605776-71605798 TTTTTGTAATGTAATAAAATAGG + Intergenic
1056121854 9:83496420-83496442 TTATTTTAAGGTAATCAAGTTGG - Intronic
1057676353 9:97138945-97138967 CTTTTCTAGGGTAGTACAGAAGG - Intergenic
1058418918 9:104816764-104816786 CTTTCCTATGCTTATAAAGTAGG + Intronic
1059210304 9:112508405-112508427 TATTTCTAAGGGAATAAAGAGGG + Intronic
1061729507 9:132602727-132602749 CTTTTGTAAGTGAATAAACTGGG - Intronic
1187418588 X:19114878-19114900 CTTGTCTAAGGTCATACAGAAGG - Intronic
1188620267 X:32212773-32212795 TTTTTCTCAGGTAAAAAAATGGG + Intronic
1189111077 X:38289673-38289695 CTTTTCTCATTTACTAAAGTAGG + Intronic
1189631838 X:42962259-42962281 CATTTTTAAGGGAAAAAAGTAGG + Intergenic
1189642620 X:43089078-43089100 CTTTGCTAAGGTAAGAATCTTGG - Intergenic
1190834161 X:54085134-54085156 GTTCTCTAAAGTAATAAAGTGGG + Intronic
1192013170 X:67297589-67297611 CTTTTCTATGTTAATAACATTGG - Intergenic
1192024210 X:67431322-67431344 CTTTTCTACTGTTTTAAAGTTGG + Intergenic
1192259866 X:69499012-69499034 CTTGTCTAAGGTCATGCAGTTGG - Intergenic
1193895083 X:87103643-87103665 TTTTTCTAAAGTAAAGAAGTTGG + Intergenic
1194267937 X:91778451-91778473 CTTTTCCAAGGTAGGAAAGGGGG - Intergenic
1194548565 X:95269183-95269205 CTCTACTAAGGTAGTAAAGAAGG - Intergenic
1194725725 X:97394426-97394448 CTTTGCTAAGGTAGGAAACTAGG - Intronic
1196331377 X:114473336-114473358 CTTCTCTTAGGTATTAATGTTGG - Intergenic
1196942258 X:120788773-120788795 CTTTTAAAAGGGAATAATGTGGG - Intergenic
1197137523 X:123080338-123080360 GGTTGCTAAGGCAATAAAGTAGG + Intergenic
1198539628 X:137623435-137623457 CTTTTCAAAGGTGACACAGTTGG + Intergenic
1200585143 Y:4999376-4999398 CTTTTCCAAGGTAGGAAAGGGGG - Intergenic
1201793359 Y:17866707-17866729 CTTATCTAAGGTAATACTGGGGG - Intergenic
1201808195 Y:18039279-18039301 CTTATCTAAGGTAATACTGGGGG + Intergenic
1202354746 Y:24034536-24034558 CTTATCTAAGGTAATACTGGGGG - Intergenic
1202516032 Y:25635573-25635595 CTTATCTAAGGTAATACTGGGGG + Intergenic