ID: 903112120

View in Genome Browser
Species Human (GRCh38)
Location 1:21144762-21144784
Sequence CTGGTAAAATGCACCTTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903112120_903112126 28 Left 903112120 1:21144762-21144784 CCCACGAAGGTGCATTTTACCAG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 903112126 1:21144813-21144835 CCTCCTAATCCTTGAAATAGAGG 0: 1
1: 0
2: 0
3: 6
4: 84
903112120_903112127 29 Left 903112120 1:21144762-21144784 CCCACGAAGGTGCATTTTACCAG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 903112127 1:21144814-21144836 CTCCTAATCCTTGAAATAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903112120 Original CRISPR CTGGTAAAATGCACCTTCGT GGG (reversed) Intronic
900548690 1:3242700-3242722 CTCGTCAATTGCACCTTGGTAGG + Intronic
901841642 1:11957604-11957626 CTTGTAAAATGCAGATTCCTGGG - Intronic
902803024 1:18842111-18842133 CTGGTAAAATTCACATCAGTTGG - Intronic
903112120 1:21144762-21144784 CTGGTAAAATGCACCTTCGTGGG - Intronic
904937958 1:34145194-34145216 CTGGGAAAAGGCATCTTCTTAGG - Intronic
906944688 1:50285666-50285688 CTTGAAAAATGCATCTTTGTTGG - Intergenic
908822036 1:68098161-68098183 CTGGGAACATGCACCTTTGAAGG + Intergenic
909600507 1:77456639-77456661 CTGGTAAAATGCCCCATCTTAGG + Intronic
909986822 1:82171403-82171425 CTATTAAAATGCAGCTTCCTGGG + Intergenic
910557199 1:88547834-88547856 TTGGGAAAATGCACCTTAGATGG - Intergenic
910767489 1:90796834-90796856 TTGATAAAATGCAGCTTCCTGGG - Intergenic
911737152 1:101350211-101350233 CTGGAAAAATGAACTTTCATTGG - Intergenic
913197318 1:116468387-116468409 CTGTTAAGATGCACATTCCTGGG - Intergenic
920836378 1:209514500-209514522 ATTGTAAAATGCACTTTGGTTGG + Intergenic
922983582 1:229849348-229849370 CTGGTGAAATGTAGCTTCCTTGG + Intergenic
1069965674 10:72113391-72113413 CTGGGAAGATGCACCTTCCCTGG - Intronic
1076479927 10:130778245-130778267 ATGGTAAAATGCAGATTCCTGGG + Intergenic
1079073497 11:17368316-17368338 CTGGTAAAATGCATCTCCCTGGG + Intronic
1080343456 11:31295377-31295399 CTGCTAAAAGGCACCTTGGGGGG - Intronic
1081631606 11:44693448-44693470 CTGGTAAAATGCAGGTTCCTGGG - Intergenic
1089031168 11:115330878-115330900 CTGCTAACATGCTCCTTCTTGGG - Intronic
1089073624 11:115719597-115719619 CTGGTAAAATGCACAACCCTGGG - Intergenic
1090570912 11:128044283-128044305 TGGGTAAAATTCACCTTTGTGGG + Intergenic
1091847918 12:3671529-3671551 CTGCTAAAATGCAGATTCGGTGG + Intronic
1093475022 12:19545131-19545153 TTGTTAAAATGCACATTCGCGGG - Intronic
1093540723 12:20281140-20281162 CTTTTAAAATGCCCCTTCCTTGG - Intergenic
1094131759 12:27082342-27082364 CTGGGAAGATGCACCTTCCAAGG - Exonic
1095133531 12:38571362-38571384 CTGGTTAAATGCTCCTCTGTGGG - Intergenic
1098849994 12:75584654-75584676 CTAGTAAAATACACATTTGTTGG + Intergenic
1101152784 12:101898632-101898654 CTCGTAAAATGCAGGTTCCTGGG + Intronic
1101478716 12:105076192-105076214 TTGTTAAAATGCAGCTTCCTGGG - Intronic
1111942693 13:94629436-94629458 CTGGTAAAATGCATCACAGTAGG - Exonic
1113123745 13:106953426-106953448 CTGTTAAAATGCAAATTCATAGG - Intergenic
1114666183 14:24378319-24378341 CTGGAAAAATGCAGCCTCCTGGG - Exonic
1121016703 14:90553274-90553296 CTGGAGAAATGCACCTTCTGGGG + Intronic
1127897920 15:63318694-63318716 CTGGTCTAATGCACCTTCCTGGG - Intergenic
1131224599 15:90613266-90613288 CTGCTAAAATGCAGATTCTTGGG - Intronic
1131754345 15:95543876-95543898 TTGTTAAAATGCACATTCTTAGG + Intergenic
1133047743 16:3098642-3098664 CTGTTAATATGCACCTCTGTTGG + Intronic
1135230181 16:20698998-20699020 CTGGTAAAATGCAGGGTCTTTGG + Intronic
1143276409 17:5714649-5714671 CTGGGAAAAAGCACCTTCTGGGG - Intergenic
1145014909 17:19390335-19390357 CTGATAAAATGCACGGTCCTGGG + Intergenic
1146785026 17:35712253-35712275 CTGGTTATATTCACCTTTGTGGG + Intronic
1147239486 17:39081156-39081178 CTTGTAAAATGCAGATTCCTGGG - Intronic
1147239756 17:39083085-39083107 ATGTTAAAATGCAGCTTCCTGGG + Intronic
1147510451 17:41064659-41064681 CTATTAAAATGCACATTCTTAGG - Intergenic
1156035365 18:32760630-32760652 TTGGTAAATTGCACCTGCGCGGG - Intronic
1158221119 18:55151782-55151804 CTAGTAAAATGCTCCTTTCTGGG + Intergenic
1159375188 18:67584062-67584084 TTGTTAAAATGCACATTTGTTGG - Intergenic
1159680871 18:71350525-71350547 CTCTTAAAAAGTACCTTCGTGGG - Intergenic
1162666885 19:12220859-12220881 CTGGTTAAGTGCCCCTCCGTGGG + Intergenic
1168591627 19:57640785-57640807 CTGGGAAGATGAACCTTCTTTGG - Exonic
928120021 2:28577357-28577379 CTAGTAAAATGCACCTGGGTTGG - Intronic
929583605 2:43100502-43100524 CTGGTAAAATGCAGTTTTCTGGG + Intergenic
939597833 2:144149195-144149217 ATGATAAAATGCACCTTGTTAGG - Intronic
940130484 2:150375803-150375825 TTGGTAAAATGCAGATTCTTAGG + Intergenic
942898537 2:181087441-181087463 TTAGTAAAATGCACATTCCTGGG - Intergenic
947039174 2:225895695-225895717 CTGTTAAAATGCAGCTTCCCAGG + Intergenic
1169912098 20:10655346-10655368 CTGTTAAAATGCAGGTTCGTGGG - Intronic
1172493423 20:35360121-35360143 CTGGTAAAATGCTGCTGCATAGG + Intronic
1183782650 22:40008651-40008673 CTGTTAAAATGCATTTTCTTGGG + Intronic
1184681221 22:46073234-46073256 GTGGTAAAATGCCCCTTTATAGG + Intronic
949286670 3:2414246-2414268 CTATTAAACTGCACCTTCTTTGG + Intronic
949493925 3:4613929-4613951 CTGGAAAGAAGCACCTTCTTGGG - Intronic
951132012 3:19058141-19058163 CTGGGAAATTGCAACTTCCTAGG - Intergenic
951615108 3:24533535-24533557 CTGGTCAAATCCACTTTAGTAGG + Intergenic
953839258 3:46375616-46375638 CTGGTAAATTGTACTTTTGTGGG - Exonic
963025501 3:140914703-140914725 CTGGGAAACAGCACCTTCGTTGG + Intergenic
965352201 3:167627364-167627386 CTGATTAAATTCACCTTTGTGGG - Intronic
965420737 3:168455450-168455472 CTGTTAAAATGCAGATTCATGGG - Intergenic
967787409 3:193512590-193512612 CTGTTAAAATGCAAATTCTTGGG + Intronic
969295035 4:6264785-6264807 CTGTTAAAATGCAGATTCCTGGG + Intergenic
973293581 4:48491757-48491779 CTCCTAAAATGCCCCTTCCTAGG + Intronic
973645791 4:52950292-52950314 CTGGAAATATGTCCCTTCGTTGG + Intronic
974193912 4:58544122-58544144 CTTATAAAATGCACTTTCCTTGG + Intergenic
976692591 4:87884557-87884579 CTGGTAAAGTGCACCTGCTTAGG + Intergenic
980899821 4:138894202-138894224 CTTGTAAAATGTACATTCTTGGG - Intergenic
980911616 4:138999431-138999453 CTGTTAAAATGCAGGTTCCTGGG + Intergenic
983583797 4:169335043-169335065 CTGGGAAACTGCATCTTTGTGGG - Intergenic
985125324 4:186688254-186688276 ATGGCAAGATGCACCTTCGGTGG + Intronic
985177930 4:187222491-187222513 CTGGTCAAGTGCAACATCGTTGG - Intergenic
986909131 5:12532671-12532693 CTGGCAAAAAGCACTTTGGTGGG - Intergenic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
991385770 5:66087369-66087391 CTTGTCAACTGTACCTTCGTTGG - Intergenic
991433066 5:66568390-66568412 CTGTTAAAATGCAGATTCCTAGG - Intergenic
993348857 5:86821345-86821367 GTGGTATCATGCACCTTCTTTGG + Intergenic
993553379 5:89304005-89304027 ATTGTAATCTGCACCTTCGTGGG + Intergenic
993856169 5:93078446-93078468 CTGGTAAAATGAAGATTCGATGG - Intergenic
998051698 5:139041360-139041382 CTGGGAAAATGAACCTTTTTGGG - Intronic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
999123394 5:149227647-149227669 CTGGTAAAATTCAGATTCCTGGG - Intronic
999449429 5:151667122-151667144 CTGATAAAATGCAGATTCCTTGG - Intronic
999590375 5:153138433-153138455 CTGGCAAAATGCAAATTCCTGGG + Intergenic
1000260754 5:159586237-159586259 TTGTTAAAATGCACATTCCTGGG + Intergenic
1001038506 5:168315260-168315282 CTTGTAAAATGCAGATTCCTGGG + Intronic
1007167503 6:39839294-39839316 TTGTTAAAATGCAGATTCGTAGG + Intronic
1009985145 6:70772894-70772916 CTAATAATATGCACATTCGTGGG + Intronic
1011773913 6:90707092-90707114 CTGGGAAAATGGAACTTGGTCGG - Intergenic
1012745473 6:103081606-103081628 TTGGTAGAATGCTCCTTCTTTGG + Intergenic
1021353644 7:19627681-19627703 CTGGTTAAATGCTCCTTCTGTGG - Intergenic
1031607663 7:123789067-123789089 CTGGATAAATACACCTTCATGGG - Intergenic
1036644418 8:10602759-10602781 TTGGTGAAATGCACATTCCTAGG + Intergenic
1039116231 8:34094295-34094317 CCGGTAAAATGCACACTCATAGG - Intergenic
1039177057 8:34820710-34820732 ATGGAAAAATGCACCTTCAGGGG + Intergenic
1047379401 8:124344351-124344373 CTGGTAAAATACTCCTTCCCTGG + Intronic
1048281552 8:133109251-133109273 TTGTTAAAATGCACGTTCCTGGG + Intronic
1048609863 8:136010381-136010403 GTTGTAAATTGCACTTTCGTAGG + Intergenic
1050836578 9:10088230-10088252 CTGGTACAATACACTTTGGTAGG - Intronic
1056605070 9:88078662-88078684 CTGGCAAACTGCTCCTTGGTGGG + Intergenic
1056707222 9:88961440-88961462 TTGGGAAAATGCACCTGCGCAGG + Intergenic
1061079514 9:128361621-128361643 CTGGGAAAATGCACCTCAGGCGG - Intergenic
1187794545 X:22988032-22988054 CTGTTAAAATGTACCTTCTGAGG + Intergenic
1188330994 X:28871650-28871672 CTGATAAAATGTACATTCCTGGG - Intronic
1190966744 X:55308082-55308104 TTGTTAAAATGCACCCTCCTGGG + Intergenic
1194582300 X:95690492-95690514 TTGGTAAAATGCACATTGGTGGG - Intergenic
1198744747 X:139878322-139878344 TTGGTAAAATAGACCTTTGTGGG - Intronic