ID: 903114443

View in Genome Browser
Species Human (GRCh38)
Location 1:21167090-21167112
Sequence TGTAAGAAATAGAACTTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903114443_903114445 -9 Left 903114443 1:21167090-21167112 CCGACCAAGTTCTATTTCTTACA 0: 1
1: 0
2: 1
3: 29
4: 282
Right 903114445 1:21167104-21167126 TTTCTTACATACTAATTACTAGG 0: 1
1: 0
2: 2
3: 15
4: 285
903114443_903114446 5 Left 903114443 1:21167090-21167112 CCGACCAAGTTCTATTTCTTACA 0: 1
1: 0
2: 1
3: 29
4: 282
Right 903114446 1:21167118-21167140 ATTACTAGGACCTAGAAAAAAGG 0: 1
1: 0
2: 1
3: 26
4: 243
903114443_903114447 10 Left 903114443 1:21167090-21167112 CCGACCAAGTTCTATTTCTTACA 0: 1
1: 0
2: 1
3: 29
4: 282
Right 903114447 1:21167123-21167145 TAGGACCTAGAAAAAAGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903114443 Original CRISPR TGTAAGAAATAGAACTTGGT CGG (reversed) Intronic
900958201 1:5901424-5901446 TGTAAGAAATTGAAATCAGTCGG + Intronic
901124946 1:6922673-6922695 TGTAACTAATAGAACTCGGCAGG - Intronic
903114443 1:21167090-21167112 TGTAAGAAATAGAACTTGGTCGG - Intronic
903625743 1:24729062-24729084 TGTAAGAAAGATAACTTGCCAGG - Intergenic
903670188 1:25030931-25030953 AGTGAGAAGGAGAACTTGGTTGG - Intergenic
905583896 1:39102585-39102607 TGAAAGAAATAGAAAGTGGCAGG + Intronic
906834145 1:49065112-49065134 AATAAGAAATAGAATGTGGTAGG + Intronic
908312319 1:62897075-62897097 TGTAGGAAACATAACTTGGGTGG - Intergenic
909755975 1:79226098-79226120 TGGAAGAAAGAGAACCTGTTTGG - Intergenic
910463469 1:87471937-87471959 TGTGAAAAACAGAACTTGATTGG + Intergenic
910677984 1:89833944-89833966 TGCAACAAATAGCACTTTGTAGG - Intronic
910791007 1:91050527-91050549 TATAGAAAATAGTACTTGGTCGG + Intergenic
911539028 1:99136338-99136360 TGTAAGAAACAGATCTTTCTTGG - Intergenic
911761720 1:101625067-101625089 TGTTAGAAGTAGAGCTTGTTGGG + Intergenic
913528446 1:119714926-119714948 TGTAAGAAACACATCTTTGTTGG - Intronic
915672637 1:157503378-157503400 TATAAGAAAGAGAACTGGGCCGG + Intergenic
916860276 1:168796186-168796208 TGGAAGAACTAGAATGTGGTTGG - Intergenic
917352789 1:174095183-174095205 TTTAAGAAATAAATCTTGGCTGG - Intergenic
919368512 1:196696543-196696565 TAAAAGAAATAGAGCTTGATGGG + Intronic
920994217 1:210972155-210972177 TATTATAATTAGAACTTGGTGGG - Intronic
921271926 1:213477882-213477904 TGTAAACAATAGACTTTGGTTGG - Intergenic
921720713 1:218467696-218467718 TCTCAGAACTATAACTTGGTGGG + Intergenic
923404757 1:233648865-233648887 AGCAAGAAATAGACCTTTGTTGG - Intronic
924802009 1:247334600-247334622 TGAAAGAAATACAACATGGTGGG + Intergenic
1064115943 10:12577517-12577539 TGGCAGAAACAGAACTTTGTTGG - Intronic
1064223717 10:13463615-13463637 TATAAAAAATAAAACTTTGTTGG + Intronic
1064331687 10:14400232-14400254 TGTAAGAATGAGGTCTTGGTAGG - Intronic
1066096155 10:32074203-32074225 TTTGAGAAATAGTACTTGGATGG - Intergenic
1067362883 10:45598168-45598190 TTAAAGAACTAGAACATGGTTGG - Intergenic
1070400431 10:76048731-76048753 AGGAAGAAATTGAACTTGTTGGG - Intronic
1070976668 10:80610779-80610801 TGTAAGAAATAAACCTTGACTGG - Intronic
1071173127 10:82892090-82892112 TGTAATAAATTCAACTTGGTTGG + Intronic
1071464248 10:85925208-85925230 TGTAAGAACAAGAACATGGGGGG - Intronic
1073721561 10:106178573-106178595 TGAAGGAGATAGAATTTGGTAGG - Intergenic
1074821531 10:117183007-117183029 TAAAAGAAATAGAAGTTGATTGG + Intergenic
1075309204 10:121397816-121397838 TGTAAGAAAGAGGACCTGGGAGG - Intergenic
1075641141 10:124065402-124065424 AATAAGTAATAAAACTTGGTAGG + Intronic
1076035158 10:127194467-127194489 TGTAAGAAATAGTACAGTGTGGG + Intronic
1076334487 10:129696356-129696378 TTGAAGACACAGAACTTGGTGGG - Intronic
1076764057 10:132621954-132621976 AGGAAGAAATAGAACTTTATTGG + Intronic
1080321848 11:31019187-31019209 TTTAAGAGAAAGAGCTTGGTAGG + Intronic
1081228593 11:40556307-40556329 CATAACAAACAGAACTTGGTAGG - Intronic
1081314641 11:41616776-41616798 TGTAAGAAATAGAGCTGGCCAGG - Intergenic
1083245274 11:61422250-61422272 TTTAAGAAATAGAACTTAGTAGG - Intronic
1084731786 11:71078522-71078544 TGTAATTAATAGATCTTGTTTGG - Intronic
1086385050 11:86298511-86298533 TGTAAGAAATTGATCTGGCTTGG - Intergenic
1086509021 11:87536037-87536059 TGTATGATTTTGAACTTGGTTGG + Intergenic
1086723794 11:90156358-90156380 TCTAAGAAATAGAAACTGGCTGG - Intronic
1087526942 11:99326880-99326902 TGTAACAAATAGAACTTTGATGG - Intronic
1088207506 11:107410918-107410940 TGTATGAAATAAAATCTGGTGGG + Intronic
1088968547 11:114750515-114750537 TTTAAGAATTAGAACTTTGCAGG - Intergenic
1092186224 12:6480823-6480845 TGTAAGAAAAAGAAATTGAGAGG + Intergenic
1093504561 12:19850178-19850200 TGGGAGAAAAAGAATTTGGTAGG + Intergenic
1094693326 12:32791790-32791812 TGTAAGAAAAAGAAATTGAGAGG - Exonic
1095411033 12:41923356-41923378 GGTAAGAAATAGTACTTACTAGG - Intergenic
1098071245 12:66677275-66677297 TGTAAGAACTATAAATTGCTTGG + Intronic
1098332469 12:69368202-69368224 TCTAAGAAAGACAAGTTGGTTGG + Intronic
1098565671 12:71932931-71932953 TCTATGAAATGGAAATTGGTAGG + Intergenic
1098817833 12:75190326-75190348 TTTAAGAAATAGAAATTAGTGGG - Intronic
1098903607 12:76138653-76138675 TATATGAAAGAGAAATTGGTTGG + Intergenic
1099035258 12:77579388-77579410 TATAAGAAATAGAAATTCCTTGG + Intergenic
1099903396 12:88740880-88740902 TTTAAAAAATAAAATTTGGTGGG + Intergenic
1100126682 12:91435813-91435835 GGAAAGAAAGAGAACTTGGCAGG + Intergenic
1102535820 12:113580150-113580172 TGTAAGAAAAAGAAAGTGGAGGG + Intergenic
1102770404 12:115471157-115471179 TGTGAGAAATATGTCTTGGTAGG - Intergenic
1102917949 12:116769061-116769083 TGTAAAAAATAAAAGTTGGCCGG + Intronic
1103830252 12:123773521-123773543 TGTGAGAAATAGATGTTTGTTGG - Intronic
1105470407 13:20688886-20688908 TATAAAAAATAAAACTTGGCTGG - Intronic
1105717045 13:23077134-23077156 TGTAAAAGATAAAACTTGGCAGG - Intergenic
1106288055 13:28335334-28335356 TCTAAGAAAGAGCACTTGGTTGG - Intronic
1107351812 13:39522632-39522654 GGGAAGAAATAGATCTTGTTTGG - Intronic
1107419118 13:40230021-40230043 TGTAAGATATAGAACAGGTTTGG + Intergenic
1109256899 13:60094670-60094692 TGTAAGAAATTTAACTTGCTAGG - Intronic
1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG + Intergenic
1110468862 13:75834749-75834771 TATAAGAGAGAGAGCTTGGTAGG + Intronic
1110480932 13:75975345-75975367 TATAAGAAAGTGATCTTGGTGGG + Intergenic
1111230208 13:85335651-85335673 TATAAGAAATATAACTTCTTAGG + Intergenic
1111854476 13:93620457-93620479 CTAAAGAAATAGAACTTGATGGG - Intronic
1112742501 13:102490994-102491016 TATAAGAATTAGAAGGTGGTAGG - Intergenic
1112879888 13:104093994-104094016 TGTAAGAACTAAAAATGGGTTGG - Intergenic
1113148029 13:107230537-107230559 TGTAAGAAATAGAATTATGGGGG + Intronic
1113977513 13:114240184-114240206 GGGAAGAAAGAGAAATTGGTAGG - Intronic
1114482254 14:23043124-23043146 TGTGAGAAGCAGGACTTGGTTGG + Exonic
1114931687 14:27476973-27476995 TGAAAGAAATAAATCTTTGTGGG - Intergenic
1115235451 14:31205623-31205645 TCCAAGAAATAAAAATTGGTAGG - Intronic
1115908516 14:38229046-38229068 TGAAAGAAATAAAACATTGTTGG - Intergenic
1116619847 14:47187092-47187114 TGTAAGAAAGAGAAATTAGGTGG + Intronic
1117484442 14:56180485-56180507 TAAAAGAGATAGAAGTTGGTTGG - Intronic
1117780309 14:59224997-59225019 TGTAAGAAATAAATCTGTGTGGG + Intronic
1119956543 14:78804242-78804264 TGTAGGAAATTAAACTTTGTGGG + Intronic
1120496213 14:85239829-85239851 TCAAAGAAATAGTACTTGTTTGG - Intergenic
1120617392 14:86724346-86724368 TGTAAGCAATTGATCTTCGTAGG - Intergenic
1121042890 14:90763936-90763958 TGTAAGAAATAATTCTTGGTAGG - Intronic
1124063426 15:26317471-26317493 TGTAAAATATAGAACATGGTAGG - Intergenic
1124879544 15:33628541-33628563 TGAATAAAATAGAACTTGGCTGG + Exonic
1125027918 15:35049322-35049344 TGGAAAATATAAAACTTGGTAGG + Intergenic
1125473926 15:40031469-40031491 TGTGAGAACTGAAACTTGGTAGG - Intronic
1126550973 15:49928988-49929010 TGTTAGAAATGCAAATTGGTGGG + Intronic
1128846629 15:70903089-70903111 TGGATGAAATAGAAGTTGGGGGG + Intronic
1128908367 15:71489696-71489718 TGCCAGAAATAGAAGATGGTGGG + Intronic
1128920984 15:71609934-71609956 TGAAAGAAAGTGAACTTGCTCGG + Intronic
1129817561 15:78568372-78568394 AGTAAGAAATATAACTAGTTAGG - Intronic
1129914787 15:79259275-79259297 TGTTAGAAATGGAAATTGTTAGG + Intergenic
1130436131 15:83901902-83901924 TGAAAGCAAAAGATCTTGGTAGG - Intronic
1131748179 15:95473031-95473053 TTTAACAAATAGAACTTTCTTGG + Intergenic
1132221177 15:100106702-100106724 TGTAAGAACTCTAACTTGGGAGG + Intronic
1134223336 16:12372610-12372632 AGTAAGAAATAGAATTCTGTAGG + Intronic
1136864437 16:33733364-33733386 TGTATTTAATAGAACATGGTTGG + Intergenic
1138109421 16:54311813-54311835 AGTAAGAAATAGAAATAGCTTGG - Intergenic
1140236616 16:73165141-73165163 TGTAAGACTGAGAACCTGGTAGG - Intergenic
1140638472 16:76944342-76944364 TGTGAGAAATACAGCTTGTTGGG - Intergenic
1141572723 16:84943947-84943969 TCTAACAAATAGAACATGGTGGG + Intergenic
1141718290 16:85739907-85739929 TGTAAGAAATGGTCCTTGCTCGG + Intronic
1141991268 16:87611756-87611778 TGTAAGAAATATAAATTCTTGGG - Intronic
1203125926 16_KI270728v1_random:1581490-1581512 TGTATTTAATAGAACATGGTTGG + Intergenic
1143216674 17:5230284-5230306 TATTGTAAATAGAACTTGGTTGG - Intronic
1143427366 17:6850689-6850711 TGTCAGAAATGGGACCTGGTTGG - Intergenic
1144091222 17:11858539-11858561 TGAAAAAAATAGAAGTTGGTGGG - Intronic
1145744175 17:27301407-27301429 TGCAAGAAATTAAACTTAGTTGG - Intronic
1145943698 17:28758132-28758154 TCTAAGAAAGGGAATTTGGTGGG - Exonic
1146749670 17:35367135-35367157 TTTGAGAAATAGAAATTTGTAGG - Intronic
1149462839 17:56846702-56846724 TGTAAAAAATACAAATTGGAAGG - Intronic
1149517650 17:57292559-57292581 TGTTAGAAATGGAGGTTGGTGGG + Intronic
1150521730 17:65874721-65874743 TGTAAGAAATAGAAACTGCATGG - Intronic
1154943341 18:21136737-21136759 TGTAAGAAATAAAAGAAGGTGGG - Intergenic
1155585381 18:27358191-27358213 TGTGAGAAACAGAACTGGTTTGG + Intergenic
1156391779 18:36657662-36657684 TGTAAGAAATACCATATGGTTGG - Intronic
1157679642 18:49594488-49594510 TTTAATAAATAGTAATTGGTAGG - Exonic
1157826065 18:50813533-50813555 TGTTAGAAATAGAAATTATTAGG - Intronic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
1161442668 19:4301241-4301263 TTTAATAAAAAGACCTTGGTTGG + Intronic
1162592934 19:11604886-11604908 TGGGAGAAAAAGAACTTGATTGG + Intronic
1165064793 19:33222738-33222760 TGGAGGAAATAGAACTGGCTGGG - Intronic
1168010464 19:53526894-53526916 TATAAGAAATATAACTTGCTGGG + Intronic
1168330843 19:55567270-55567292 TGTAAGAAAGAAAACCAGGTGGG + Intergenic
1168334301 19:55588523-55588545 ATTAAGAACTAGAACTTTGTCGG + Intergenic
925453623 2:3993843-3993865 GGTGAGAAATTGAACTTGTTTGG - Intergenic
926501812 2:13664368-13664390 TTTAAGAAATAGAATTCTGTAGG - Intergenic
926924791 2:17976598-17976620 TGTTAGAGATAGGGCTTGGTAGG - Intronic
930530730 2:52585027-52585049 TGGATGAAATAGAACTTTCTTGG + Intergenic
931904715 2:66830083-66830105 TGTAAGATACAGAAGTTTGTAGG - Intergenic
934632747 2:95947084-95947106 TGTATTTAATAGAACATGGTTGG + Intronic
934800753 2:97156173-97156195 TGTATTTAATAGAACATGGTTGG - Intronic
935184225 2:100717072-100717094 TTTATGTAATAGTACTTGGTTGG + Intergenic
936681438 2:114777439-114777461 TGGAAGAAATATAATTTAGTAGG - Intronic
937159666 2:119748056-119748078 TGTAACAAATAGAATATTGTAGG + Intergenic
937177391 2:119953928-119953950 TGCAAGAAGTAGACCCTGGTGGG - Intronic
938272098 2:129981645-129981667 TGTAAGCAATAGATTTTGCTTGG + Exonic
939524678 2:143277995-143278017 TGTAACAAATACAACCTGGAGGG - Intronic
940719591 2:157267574-157267596 TGGCAGAAATAGTACTAGGTGGG - Intronic
941181028 2:162259481-162259503 TGTAAGAAATCTAACTTGATAGG + Intergenic
941397461 2:164991110-164991132 TGAAAGAAATAAAAGTTGCTTGG + Intergenic
941677139 2:168355895-168355917 TGTAGGAAATAGAACAAGGTGGG - Intergenic
942645761 2:178109523-178109545 TGTAAGAATTAGAACTCACTGGG + Intergenic
942679988 2:178468059-178468081 TGTAAGAAGTTGAACTGGGTGGG + Intronic
943224902 2:185159837-185159859 TGTAACAAATAGGACTGGTTGGG - Intergenic
943519574 2:188931578-188931600 TGTAAGAGAGAGAACCTGGCTGG + Intergenic
944354482 2:198769746-198769768 TGTAAAATATAGAACTTTGAAGG - Intergenic
944866212 2:203865104-203865126 TGAAAGAAACAAAACTTGCTGGG + Intergenic
945160540 2:206885721-206885743 TCCAAGAAATAGACTTTGGTTGG - Intergenic
945573412 2:211499768-211499790 TCTCAGAAATAGAACTTTTTGGG - Intronic
945741647 2:213670294-213670316 TTTAAGAATTAGAACATGCTTGG - Intronic
946126343 2:217566363-217566385 TGTTGGAAGTAGGACTTGGTGGG - Intronic
946330304 2:219005320-219005342 CTTGAGAAATAGAACTTGGTGGG - Intronic
946682244 2:222229668-222229690 TGGAAGAAATAGGGTTTGGTAGG - Intronic
947691252 2:232138484-232138506 TTTAAGAAATAAAACATGGTAGG + Intronic
1169483283 20:6005041-6005063 TGTAAGAAATAGATTTTTTTTGG + Intergenic
1170005677 20:11666568-11666590 TGTAAGCAAGAGAATTTGGCTGG + Intergenic
1170481765 20:16773046-16773068 TGTTAGAAATGGAGCCTGGTGGG + Intergenic
1170558763 20:17537819-17537841 TGTAAGAAAATGACCTTGGCTGG + Intronic
1170636538 20:18110126-18110148 TCTATAAAATAGAACTTGCTGGG + Intergenic
1170932073 20:20778200-20778222 TGTAAGAAATAAAATTTGCCAGG + Intergenic
1171139966 20:22732691-22732713 TGTAACAAAAATAACTTGCTGGG - Intergenic
1172492468 20:35351088-35351110 CTTAAGAAATAGCACTTTGTAGG + Intronic
1174867953 20:54155940-54155962 TGAAATAAATAGCACCTGGTTGG + Intronic
1174990561 20:55504627-55504649 TGTTAGAAATACAAAATGGTGGG - Intergenic
1177073505 21:16542569-16542591 TGTCAGATATAGAAATTGATAGG + Intergenic
1177340550 21:19794449-19794471 AGCAAGAAATAGAACTTAATAGG + Intergenic
1181386028 22:22546480-22546502 TATAAGAAATAGAAATTGGCTGG - Intergenic
1182971818 22:34586417-34586439 TGTATGAAAAAGAATTTGGCTGG + Intergenic
1183422914 22:37722774-37722796 TGAAGGAAATAGAACTGGGAAGG + Intronic
1185036465 22:48479653-48479675 TGTCAGAAAAAGAACCTGGCAGG + Intergenic
950595506 3:13977370-13977392 TTTAAGTATTAGAACATGGTAGG - Intronic
950780129 3:15384575-15384597 TGTAAGAAAAAAAAATTAGTTGG + Intronic
952563638 3:34627972-34627994 TGAAAGCAACAGAACTTAGTTGG + Intergenic
953141113 3:40230292-40230314 TGTAAGCAATAGAAATAGGTAGG + Intronic
953160479 3:40415082-40415104 TGTAAGAAATTGAAGGGGGTGGG + Intronic
953617466 3:44504155-44504177 TATAAGAACTAAAACTTGCTGGG + Intronic
953948896 3:47172787-47172809 TTTTAGAAATAGAATTTGCTGGG - Intergenic
954516437 3:51181896-51181918 TGTTAGAAATGGAAATTGTTGGG - Intronic
956664407 3:71629048-71629070 TGTCAGATATAGAATTTTGTGGG - Intergenic
956732356 3:72208191-72208213 TGTAAAAAGTGGAATTTGGTGGG - Intergenic
957575623 3:82003765-82003787 TGTAACAAATAGGACTTTTTTGG + Intergenic
960559669 3:119069936-119069958 TGTAAGAAAAAGCAATGGGTAGG + Intronic
960850500 3:122047936-122047958 GGTAAGAAAAAGAAATAGGTGGG - Intergenic
962093759 3:132272179-132272201 TCTAAGAAATAGGACTTGACAGG + Intronic
962165880 3:133047358-133047380 TGTCAGAAATAGCACTTGGCTGG + Intronic
964266241 3:154898778-154898800 ACTAAGAACTAGAACATGGTTGG - Intergenic
964746516 3:160017656-160017678 TGTAAAAATTAGAACTAGGCTGG - Intronic
964912978 3:161804303-161804325 AATAGGAAAAAGAACTTGGTGGG + Intergenic
965586420 3:170322626-170322648 TGTAACAAATAATACATGGTTGG - Intergenic
967598103 3:191351670-191351692 TATAAGAGATAGAGTTTGGTTGG + Intronic
968177199 3:196561264-196561286 TGTGAGGCATAGAGCTTGGTGGG + Exonic
968864638 4:3200234-3200256 TTTAAGGACTAGAACTTAGTAGG - Intronic
969084369 4:4644816-4644838 TTTAAAAAATAGAAATGGGTTGG + Intergenic
970140572 4:12977569-12977591 TGTAAGAATTAGCTCTAGGTTGG + Intergenic
970962215 4:21885514-21885536 AACAAGAAATAGAAGTTGGTGGG - Intronic
971743455 4:30550262-30550284 AGTAAGAAATAGGAGTTGGGAGG - Intergenic
972930365 4:44064458-44064480 TGTTAGAAATGGGACTTAGTGGG + Intergenic
972995896 4:44879307-44879329 TATAAGAAATAGAAATGGTTAGG - Intergenic
973620795 4:52723352-52723374 TTTAAGAAACAGAACATGGCGGG + Intronic
976018181 4:80585921-80585943 TGTAAGAAATAGTGATTTGTAGG + Intronic
977426836 4:96877012-96877034 TGTTAGAAGTAGAACCTGGTGGG - Intergenic
977695075 4:99956007-99956029 TGTAAGAAGTAGCACTTAGAAGG + Intergenic
977875039 4:102139633-102139655 TTTCAGAAATAGATCTTGGATGG + Intergenic
980042955 4:127960835-127960857 TGAAAGGGATAGAATTTGGTGGG - Intronic
980302688 4:131014467-131014489 GATAGGAACTAGAACTTGGTGGG + Intergenic
980556345 4:134410468-134410490 TGTGAAACATAGAACTTGATAGG - Intergenic
980839145 4:138236617-138236639 TGTTAGAAAAGGAACTTGGCGGG - Intronic
980945863 4:139319727-139319749 ATTAAGAAATAGAACTTGGCTGG - Intronic
980950938 4:139375797-139375819 TGTAATTAATAAAAATTGGTAGG + Intronic
981382856 4:144093696-144093718 TATAAGAAATACCACTTAGTAGG + Intergenic
981442314 4:144797224-144797246 TGTTGGAAATGGAACCTGGTGGG + Intergenic
982488799 4:156002207-156002229 GGTCAGAAACAGAACGTGGTGGG + Intergenic
982569267 4:157027603-157027625 TCTCAGAAATAGAACTAGGATGG - Intergenic
983029161 4:162777529-162777551 TGTCTGAAATAAAACTTGATTGG + Intergenic
983544354 4:168947254-168947276 TGTAAGAAAAAGAAAGTGATGGG - Intronic
983686758 4:170419418-170419440 TGTAAGAAAAAGAACAATGTTGG + Intergenic
984109729 4:175597128-175597150 TGAAAGAAATAGACATTGGAAGG + Intergenic
984289475 4:177776961-177776983 AGGTAGAAATAGAACTTGATTGG + Intronic
984414910 4:179446042-179446064 TGAGAGAAATAGAACTTATTGGG + Intergenic
988944596 5:36183561-36183583 TTTAAGAAGTAGAATTTGGCTGG - Exonic
991167195 5:63577392-63577414 TGTTAGAAATAGGATTTTGTTGG + Intergenic
993506245 5:88712291-88712313 TGTAAGAAATAGTAGTAGGGAGG - Intergenic
994225241 5:97244481-97244503 TGTAACAAATAGAAGTTGAGTGG + Intergenic
995178417 5:109206235-109206257 TGTAAGAAAAAGAAATAGGCTGG + Intergenic
999143160 5:149376248-149376270 TATAAGAAATAGCACTTCCTGGG + Intronic
999815821 5:155174957-155174979 TGAAAGAAATAGGATTTGATCGG - Intergenic
999921444 5:156325931-156325953 TGTAAGTAATAGGATTCGGTGGG - Intronic
1000202549 5:159026027-159026049 TGAATGAAATAGAGCATGGTGGG + Intronic
1000705970 5:164512412-164512434 TGTAAGAATAAGAACATAGTTGG + Intergenic
1001460740 5:171911361-171911383 TGTTAGAAATAGAAATTCATGGG - Intronic
1003458403 6:6306411-6306433 TGTAAGAAGTGGAACATGTTAGG - Intronic
1003622265 6:7711253-7711275 TCTAATGAATAGAACATGGTAGG - Intergenic
1003832226 6:10024092-10024114 TGAAAGAAATAAAACTTAGCAGG - Intronic
1004301327 6:14460672-14460694 TCTAAGAAATAAAAATTGTTGGG + Intergenic
1004603158 6:17170181-17170203 TTTAAGAGCTAGGACTTGGTAGG - Intergenic
1005058035 6:21748495-21748517 TGTAGTAAATAGAGCTTAGTTGG + Intergenic
1006213538 6:32418358-32418380 TGAAGGAAATAGAAATTGTTAGG + Intergenic
1006411391 6:33875937-33875959 TCTAAGAAATAGGAGATGGTAGG - Intergenic
1008586776 6:52957822-52957844 CTTAAGAAATAGAACATTGTTGG - Intergenic
1009331732 6:62430745-62430767 TTTAAGAAATAAAATTTGATTGG + Intergenic
1009952253 6:70411728-70411750 TGAATGAAAAAGAACTTGGGTGG - Intergenic
1010144046 6:72645435-72645457 TGTAAGTAAGAGTATTTGGTGGG - Intronic
1010835283 6:80579514-80579536 TGTAAGAAACAGAAGTTATTTGG + Intergenic
1011267882 6:85543416-85543438 TGTCAGAACTAGAGCTTGGTTGG - Intronic
1011607720 6:89120249-89120271 TATAAGAGATAGAACTGGATAGG - Intergenic
1011856425 6:91698550-91698572 TTTAAGAAATACATCTTGTTAGG - Intergenic
1012615967 6:101280692-101280714 TGTAGGAAATAGTATGTGGTGGG - Intergenic
1013773967 6:113658440-113658462 GGTAAGAATTACAACTAGGTTGG - Intergenic
1014477927 6:121897507-121897529 TGGAAGAAAGGGAACTTGTTAGG + Intergenic
1014483093 6:121962712-121962734 TTTAAGAAATAAAAATTGCTTGG + Intergenic
1015105359 6:129530293-129530315 TGAATAAAATAGAACTTTGTTGG + Intergenic
1015798132 6:137033399-137033421 TGTAAGAGGTAGGACCTGGTGGG + Intronic
1016210311 6:141524227-141524249 TGTAAGAAATAAATATTTGTTGG + Intergenic
1016298717 6:142605178-142605200 TTTAAGAAATAGCACTTTATGGG + Intergenic
1016666804 6:146651508-146651530 TTTAAGAAGGAAAACTTGGTAGG + Intronic
1017121748 6:151030480-151030502 TTTAAGAAATAAAAGTTGGTAGG - Intronic
1018237046 6:161736718-161736740 TGTAAGATATACAACTTTCTGGG + Intronic
1019723788 7:2589397-2589419 TTTAAAATATAGAACTTGTTGGG + Intronic
1020678247 7:11205229-11205251 TTTCATAAATAGAACTTTGTGGG + Intergenic
1020834508 7:13132186-13132208 TACAATGAATAGAACTTGGTTGG + Intergenic
1021191195 7:17621625-17621647 TGAAATAAATAGAAATTTGTAGG - Intergenic
1022643703 7:32211723-32211745 AGAAAGAAATAGAGCTGGGTGGG + Intronic
1026556029 7:71409372-71409394 TGTAAGAAATACAAGTTCTTGGG + Intronic
1027140564 7:75654096-75654118 TCTAAGAAACAGAACATGGCCGG + Intronic
1031594656 7:123635250-123635272 TATAGGAAATAGAACTTTGCCGG - Intronic
1031822175 7:126516679-126516701 TCTAAGAAAGAGAACATGGGAGG + Intronic
1031851334 7:126868025-126868047 GGTAAGACATAGAGCTTGGCTGG + Intronic
1032343710 7:131100043-131100065 TGTAAGAAATATACATTAGTGGG + Intergenic
1033404563 7:141060205-141060227 TGCAAGAAACATAACTTGCTGGG + Intergenic
1036067985 8:5405568-5405590 TCTAAGAAATAGAACTGGGCCGG - Intergenic
1036462860 8:8969530-8969552 TCTAAAAGATGGAACTTGGTTGG + Intergenic
1037647792 8:20809447-20809469 TGTTATAAATACCACTTGGTTGG - Intergenic
1040037900 8:42888358-42888380 TAAAAGAAATAGAATTTGGCTGG - Intronic
1041527645 8:58824875-58824897 GGGAAAAAATAGAGCTTGGTTGG + Intronic
1041780201 8:61569690-61569712 TATGAGAAAGAAAACTTGGTAGG + Intronic
1043021264 8:75002806-75002828 CGTGAGACATAGAACTTGGCAGG + Intronic
1044240656 8:89884665-89884687 TAGAATAAATACAACTTGGTCGG - Intergenic
1044471580 8:92575355-92575377 TTTTAGAAATAGAACTCTGTTGG - Intergenic
1046674378 8:117092669-117092691 TGTAAGAAACAGAGCTGGGGAGG + Intronic
1047570047 8:126087837-126087859 TGTTAGAAATACAAATTGTTGGG + Intergenic
1049855387 8:144858550-144858572 GGTAAGAATTAGAACTGGCTGGG + Intergenic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1052577919 9:30313372-30313394 TGTTAGAACTAGAGCCTGGTGGG - Intergenic
1052584051 9:30401752-30401774 TGTAGGAAGTAGAAAATGGTTGG - Intergenic
1054822176 9:69533811-69533833 TGTAAAATATAGAACTTGTTGGG - Intronic
1055290927 9:74781054-74781076 TTTAAGAAAGAGAACTGGGCTGG + Intronic
1055641326 9:78320814-78320836 TGTGAGTAAAAGCACTTGGTGGG + Intronic
1056243751 9:84673294-84673316 TGTAAGAAAAAGAACATAGATGG - Intronic
1185483814 X:467522-467544 AGTCAGAAACAGAACTTGGGGGG - Intergenic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1186762717 X:12740189-12740211 TGTAACCAATAGAATTTGGTGGG - Intergenic
1187215245 X:17269520-17269542 TGGAAGAAAGGGTACTTGGTGGG - Intergenic
1189232545 X:39463837-39463859 TGTGAGAAATCGAACATGTTTGG + Intergenic
1192332087 X:70183733-70183755 TGTAAAAAATAGAACAGGTTGGG + Intronic
1193279803 X:79633438-79633460 TGTAAGATATAATAATTGGTGGG - Intergenic
1194011846 X:88571205-88571227 TGTTAGAAATGTAAATTGGTGGG - Intergenic
1194878303 X:99218295-99218317 TATAAGAAATAGAAATTTGTTGG + Intergenic
1198360531 X:135890840-135890862 TTTAAGAAAAAGAACTAAGTTGG + Intronic
1199095698 X:143735991-143736013 TGTAAGCATTGGAACTTGGTTGG - Intergenic
1201298160 Y:12483031-12483053 TGTTAAAAATAGAAATTGGGCGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic