ID: 903115791

View in Genome Browser
Species Human (GRCh38)
Location 1:21177205-21177227
Sequence GTTCGCTGAGCCCCGCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903115778_903115791 27 Left 903115778 1:21177155-21177177 CCCCTGCGGCCCAGCCTCGAAGA 0: 1
1: 0
2: 0
3: 44
4: 1544
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115780_903115791 25 Left 903115780 1:21177157-21177179 CCTGCGGCCCAGCCTCGAAGAAC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115779_903115791 26 Left 903115779 1:21177156-21177178 CCCTGCGGCCCAGCCTCGAAGAA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115783_903115791 17 Left 903115783 1:21177165-21177187 CCAGCCTCGAAGAACAATGGTAA 0: 1
1: 0
2: 1
3: 3
4: 108
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115789_903115791 -10 Left 903115789 1:21177192-21177214 CCCGGAGTCGGCTGTTCGCTGAG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115788_903115791 -9 Left 903115788 1:21177191-21177213 CCCCGGAGTCGGCTGTTCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115782_903115791 18 Left 903115782 1:21177164-21177186 CCCAGCCTCGAAGAACAATGGTA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115785_903115791 13 Left 903115785 1:21177169-21177191 CCTCGAAGAACAATGGTAATGGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
903115777_903115791 30 Left 903115777 1:21177152-21177174 CCTCCCCTGCGGCCCAGCCTCGA 0: 1
1: 0
2: 4
3: 34
4: 357
Right 903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903115791 Original CRISPR GTTCGCTGAGCCCCGCTCGC AGG Intergenic
903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG + Intergenic
907452934 1:54558909-54558931 GGTCGCTGAGCCCAGCGTGCGGG - Intronic
910652622 1:89586167-89586189 GATGGCTGAGCCCCGCTCCCAGG + Intronic
912541554 1:110420088-110420110 GCTCACTGAGCCCCACTTGCTGG - Intergenic
920461179 1:206141517-206141539 GTTCCCTGACCCCCCCTCGCAGG - Intergenic
923224106 1:231923340-231923362 TTTCGCTGAGCCCTCCTGGCAGG + Intronic
1065101037 10:22334100-22334122 GTGCGGTGCGCCCCGCTCTCCGG - Intergenic
1077038595 11:507347-507369 CTTAGCCGAGCCCCGCCCGCCGG - Intergenic
1084939117 11:72602887-72602909 GTTGGCTGGGCCCTGCTCTCAGG - Intronic
1086321208 11:85649492-85649514 GTTTGCTGAGCCCTGATCTCAGG + Intronic
1088448345 11:109955526-109955548 GTTCCCTGACCCCCCCTAGCAGG - Intergenic
1095183914 12:39178823-39178845 GTTCCCTGACCCCCACTTGCAGG - Intergenic
1116973608 14:51093846-51093868 GCGCCCTGAGTCCCGCTCGCAGG + Intronic
1119023732 14:71136550-71136572 GTTCTCTGACCCCCCCTCGCAGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1126276907 15:46894697-46894719 GTTCCCTGACCCCCACTCACAGG + Intergenic
1132929570 16:2451927-2451949 GTTGGCTGAGTCACGCTGGCAGG - Intronic
1133169364 16:3971666-3971688 GTTTTGTGAGCCCCGCTCGTTGG + Intronic
1138328052 16:56191646-56191668 CTTCGCCGACCCCCGCGCGCTGG - Intronic
1146507246 17:33416111-33416133 GTTGGCTGAGCCTGGCTCCCTGG + Intronic
1149696885 17:58623063-58623085 GCACGCTGAGCCCCGCTCCATGG - Intronic
1151423418 17:74013882-74013904 CTTCCCTGAGCCCCGATTGCAGG - Intergenic
1160502702 18:79410274-79410296 GTTTGCTGAGGCCCGCTCCTTGG + Intronic
1161689115 19:5720610-5720632 GTGCGCGGAGGCCCGCTCCCGGG + Intergenic
1161812183 19:6477198-6477220 GGTCCCCGAGCCCCGCTCACCGG + Exonic
1164705232 19:30314653-30314675 GTGCTCTGATCCCGGCTCGCTGG + Intronic
1166838295 19:45681045-45681067 GTTAGCTGAGCACTGCTGGCTGG - Intronic
1167258015 19:48442727-48442749 GTCCACTGAGGCGCGCTCGCGGG - Exonic
926286955 2:11496211-11496233 GTGCGCTGATCCCAGCTCACAGG + Intergenic
943725245 2:191245739-191245761 GCCCGCTGACCCCCGCCCGCAGG - Intronic
946858783 2:223979851-223979873 GTTTGCTGACCCCTGCTCTCAGG - Intronic
946987309 2:225287151-225287173 GTTCCCTGACCCCCCCTTGCAGG - Intergenic
947749213 2:232524031-232524053 GTCCGCAGAGCTGCGCTCGCTGG + Exonic
1171241033 20:23567065-23567087 GTTCTCTGACCCCTGCTCTCTGG - Intronic
1172836959 20:37879238-37879260 GTCGGCTCAGCCCCACTCGCTGG + Intergenic
1175908841 20:62395046-62395068 GTACCTTGAGCCCCGCTCCCCGG - Intronic
1176385330 21:6136145-6136167 ACCCGCTGAGCCCCGCTCTCAGG - Intergenic
1179738143 21:43402107-43402129 ACCCGCTGAGCCCCGCTCTCAGG + Intergenic
1180018213 21:45101269-45101291 GCTCGCTGTGCCCTGCGCGCGGG + Intronic
1180612068 22:17104571-17104593 GTTCGCTGACCCGCCCTTGCTGG + Intronic
1185349543 22:50327279-50327301 GTTCGCGGATCCCGGCTCGCGGG + Intergenic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
966645519 3:182242413-182242435 GTTCTCAGGGCCCAGCTCGCTGG - Intergenic
968278156 3:197456611-197456633 GCTCGCTGACCCCGGCTCCCAGG + Intergenic
973864403 4:55097406-55097428 GTTGGCTGAGCCCTGCACGAGGG + Intronic
979341518 4:119529989-119530011 GATTGCTGAGCCCCACTCCCAGG - Intronic
980464492 4:133154315-133154337 GATAGCTGAGCTCTGCTCGCTGG - Exonic
986312125 5:6558475-6558497 GTTCACTGAGCTCAGCTGGCTGG - Intergenic
988922773 5:35960420-35960442 GTTCCCTGACCCCCCCTCACAGG + Intronic
1005580470 6:27229610-27229632 CTTCTCTGAGTCCCGCTCTCTGG + Intergenic
1018910042 6:168096581-168096603 GTGCCCTGAGCCCGGCTCCCAGG + Intergenic
1019147634 6:169985244-169985266 GTTGGCTCTGCCCGGCTCGCTGG + Intergenic
1020137431 7:5594727-5594749 GTGCGCTGAGCTCCGCTCCGCGG + Intronic
1021082978 7:16385770-16385792 GTTCCCTGACCCCCCCTCACAGG + Intronic
1030115293 7:106058343-106058365 GTTCCCTGAGCCCAGCTCTCAGG - Intergenic
1034750598 7:153565085-153565107 CTGCTCTGAGCCCCGCTGGCTGG - Intergenic
1035094817 7:156345665-156345687 GGCCGCTGTTCCCCGCTCGCTGG - Intergenic
1035370464 7:158376380-158376402 GTCCCCTGACCCCCCCTCGCAGG - Intronic
1053313948 9:37036617-37036639 AATCGCAGAGCCCCCCTCGCGGG + Intergenic
1053357146 9:37455695-37455717 GTTCTCTGAACCCCCCTCGCAGG - Intronic
1061680920 9:132242103-132242125 GGCCGCTGAGCCCCGCCCGGAGG + Exonic
1185490984 X:516770-516792 ATTGGCTGAGCCCTGCTCCCGGG - Intergenic
1195134186 X:101887261-101887283 GTTCAGTGAGCCCCACTCTCAGG + Intronic