ID: 903117830

View in Genome Browser
Species Human (GRCh38)
Location 1:21192678-21192700
Sequence TGGCAGCAGGAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903117830_903117834 -1 Left 903117830 1:21192678-21192700 CCTTCCTCACTCTCCTGCTGCCA No data
Right 903117834 1:21192700-21192722 ATTCTGCCCCCTCCCCACTCTGG No data
903117830_903117842 24 Left 903117830 1:21192678-21192700 CCTTCCTCACTCTCCTGCTGCCA No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903117830 Original CRISPR TGGCAGCAGGAGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr