ID: 903117834

View in Genome Browser
Species Human (GRCh38)
Location 1:21192700-21192722
Sequence ATTCTGCCCCCTCCCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903117831_903117834 -5 Left 903117831 1:21192682-21192704 CCTCACTCTCCTGCTGCCATTCT No data
Right 903117834 1:21192700-21192722 ATTCTGCCCCCTCCCCACTCTGG No data
903117828_903117834 29 Left 903117828 1:21192648-21192670 CCAGAGGAGATGCTTGGGGGACA No data
Right 903117834 1:21192700-21192722 ATTCTGCCCCCTCCCCACTCTGG No data
903117830_903117834 -1 Left 903117830 1:21192678-21192700 CCTTCCTCACTCTCCTGCTGCCA No data
Right 903117834 1:21192700-21192722 ATTCTGCCCCCTCCCCACTCTGG No data
903117829_903117834 0 Left 903117829 1:21192677-21192699 CCCTTCCTCACTCTCCTGCTGCC No data
Right 903117834 1:21192700-21192722 ATTCTGCCCCCTCCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903117834 Original CRISPR ATTCTGCCCCCTCCCCACTC TGG Intergenic
No off target data available for this crispr