ID: 903117842

View in Genome Browser
Species Human (GRCh38)
Location 1:21192725-21192747
Sequence CTGCCCACCAAGTTCAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903117829_903117842 25 Left 903117829 1:21192677-21192699 CCCTTCCTCACTCTCCTGCTGCC No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117830_903117842 24 Left 903117830 1:21192678-21192700 CCTTCCTCACTCTCCTGCTGCCA No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117832_903117842 11 Left 903117832 1:21192691-21192713 CCTGCTGCCATTCTGCCCCCTCC No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117835_903117842 -4 Left 903117835 1:21192706-21192728 CCCCCTCCCCACTCTGGCACTGC No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117836_903117842 -5 Left 903117836 1:21192707-21192729 CCCCTCCCCACTCTGGCACTGCC No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117837_903117842 -6 Left 903117837 1:21192708-21192730 CCCTCCCCACTCTGGCACTGCCC No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117838_903117842 -7 Left 903117838 1:21192709-21192731 CCTCCCCACTCTGGCACTGCCCA No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117833_903117842 4 Left 903117833 1:21192698-21192720 CCATTCTGCCCCCTCCCCACTCT No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117831_903117842 20 Left 903117831 1:21192682-21192704 CCTCACTCTCCTGCTGCCATTCT No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data
903117839_903117842 -10 Left 903117839 1:21192712-21192734 CCCCACTCTGGCACTGCCCACCA No data
Right 903117842 1:21192725-21192747 CTGCCCACCAAGTTCAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903117842 Original CRISPR CTGCCCACCAAGTTCAAAAG CGG Intergenic
No off target data available for this crispr