ID: 903120066

View in Genome Browser
Species Human (GRCh38)
Location 1:21210388-21210410
Sequence AGTTATCCACAGAGGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903120066_903120072 27 Left 903120066 1:21210388-21210410 CCCACCATCCTCTGTGGATAACT No data
Right 903120072 1:21210438-21210460 CAAGTCTCACTCTGTCGCCCAGG 0: 79
1: 1266
2: 19828
3: 98574
4: 163849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903120066 Original CRISPR AGTTATCCACAGAGGATGGT GGG (reversed) Intergenic
No off target data available for this crispr