ID: 903120066 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:21210388-21210410 |
| Sequence | AGTTATCCACAGAGGATGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903120066_903120072 | 27 | Left | 903120066 | 1:21210388-21210410 | CCCACCATCCTCTGTGGATAACT | No data | ||
| Right | 903120072 | 1:21210438-21210460 | CAAGTCTCACTCTGTCGCCCAGG | 0: 79 1: 1266 2: 19828 3: 98574 4: 163849 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903120066 | Original CRISPR | AGTTATCCACAGAGGATGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||