ID: 903122421

View in Genome Browser
Species Human (GRCh38)
Location 1:21225066-21225088
Sequence GGTGGGGGAGCCTCCACGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903122409_903122421 17 Left 903122409 1:21225026-21225048 CCAGACTCAGAGCACAAAGCCTT 0: 1
1: 0
2: 0
3: 14
4: 193
Right 903122421 1:21225066-21225088 GGTGGGGGAGCCTCCACGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 143
903122411_903122421 -2 Left 903122411 1:21225045-21225067 CCTTCTGGTGCCAAGCCCTGTGG 0: 1
1: 0
2: 4
3: 50
4: 296
Right 903122421 1:21225066-21225088 GGTGGGGGAGCCTCCACGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903122421 Original CRISPR GGTGGGGGAGCCTCCACGGT CGG Intronic
900872185 1:5312019-5312041 GGTGGGGGATACTCCTCTGTGGG - Intergenic
901328950 1:8389681-8389703 AGTCGGGGAGCCACCACGGAAGG + Intronic
902513893 1:16979952-16979974 GGTGGGGCAGCCTCCCAGGCAGG - Intronic
903122421 1:21225066-21225088 GGTGGGGGAGCCTCCACGGTCGG + Intronic
904990690 1:34590333-34590355 GGTGGGGGAGGCCCCCCTGTTGG - Intergenic
907258383 1:53197205-53197227 GCTGTGGCAGCCTCCATGGTAGG - Intronic
908089539 1:60671423-60671445 GTTGGGGGGGCCTGCAGGGTGGG + Intergenic
911025073 1:93427301-93427323 GGAGGGGGAGCCTCCTCTGCAGG - Intergenic
914899494 1:151704191-151704213 GCTGGGGGGGCCCCCAGGGTTGG + Intronic
915905403 1:159873229-159873251 GGTGGGGGAGCCTCCTGGGTGGG + Intronic
919522520 1:198606121-198606143 GGTGGGGGACCCTCAAGGGATGG + Intergenic
920003015 1:202812173-202812195 GTTGAGGGAGCCTCCACAATGGG + Intergenic
920524758 1:206658576-206658598 GCTGCGGGAGCCTCCTGGGTGGG + Intronic
1064622979 10:17233715-17233737 GGTAAGGCAGCCCCCACGGTTGG + Intronic
1069785630 10:70986211-70986233 GGTTGGGGAGGCTCCCCGGGAGG - Intergenic
1070752564 10:78972824-78972846 GCTGGGTGAGCCCCCACCGTGGG - Intergenic
1070879544 10:79845338-79845360 GGTGGTGGAGCCTGCACAGGGGG + Intronic
1071632652 10:87229428-87229450 GGTGGTGGAGCCTGCACAGGGGG + Intronic
1071646100 10:87361646-87361668 GGTGGTGGAGCCTGCACAGGGGG + Intronic
1071884734 10:89937303-89937325 GGTGTGGGACCCTCCAAGCTAGG + Intergenic
1072791546 10:98321620-98321642 GGTCAGGGAGGCTCCACGGACGG - Intergenic
1077299990 11:1842337-1842359 GAGGGGCGAGCCTGCACGGTGGG + Intergenic
1077536572 11:3127539-3127561 GGTGGGGGAGCAGCCACTGCCGG - Intronic
1085416505 11:76322068-76322090 GGTGGGGGAGGCTGCCCGGCGGG + Intergenic
1087750882 11:102005650-102005672 GGTGGTGAAGCCTCCCCTGTGGG - Intergenic
1089814767 11:121162543-121162565 GGTGGGTTAGGCTCCACGGGAGG - Intronic
1090663634 11:128900469-128900491 GGTGGGGAATCCTCCAAGGATGG + Exonic
1092192237 12:6529429-6529451 GCTGGGGGAGGGTCCAGGGTTGG + Intronic
1094835296 12:34319360-34319382 GGTGGGGGGGCATGCACCGTGGG + Intergenic
1097264514 12:57737833-57737855 GGTGGGGGCGCCCCCAGGCTTGG + Exonic
1100427915 12:94504272-94504294 GCTAGGGGAGCCTCCATGCTAGG + Intergenic
1101718477 12:107331595-107331617 GGTGGGGAAGCCTGCAGGGATGG + Intronic
1113654103 13:112057411-112057433 GGTGGGGGAGCCGCGAGGGGCGG - Intergenic
1113927356 13:113949154-113949176 GGTTGGGGAGCCCCCAGGCTGGG + Intergenic
1119500241 14:75120438-75120460 GTTGGGGGGGTATCCACGGTAGG + Intronic
1122792431 14:104189980-104190002 GGTGGGGGAGCCCCCATGCCAGG - Intergenic
1127262288 15:57335158-57335180 GGTCGGGGAGCCTCCATGTCAGG + Intergenic
1128053302 15:64682068-64682090 GGTGGGGGTCCCTCCCTGGTGGG - Exonic
1128599892 15:68987410-68987432 GGAGAGGAAGCCTCCACAGTGGG - Intronic
1132549748 16:549471-549493 GGTGGGGCGGCCTGCAGGGTGGG + Exonic
1132863734 16:2083741-2083763 GCTGGTGGAGCCCCCAGGGTTGG + Exonic
1133634693 16:7653951-7653973 AGTGGGGCAGCCTCCTGGGTGGG + Intronic
1137532389 16:49287649-49287671 GGTGGGGGAGCATGCACATTAGG - Intergenic
1139591199 16:67934268-67934290 GGTGGGGGAGCCTTCAAGTGTGG + Intronic
1141703207 16:85651746-85651768 GGTGGGGAGGCCTCCAGGGCAGG - Intronic
1141922603 16:87146002-87146024 GCTGGGGGAGCGTCCCTGGTTGG + Intronic
1142624177 17:1181378-1181400 GGTGGGGAAGCCTCTACAGGTGG + Intronic
1143524153 17:7462720-7462742 GCTGTGGGAGCCCCCACCGTGGG + Exonic
1143708805 17:8719023-8719045 GGTGTGGGAGGCTCCAGAGTGGG - Intergenic
1144679136 17:17181260-17181282 GGTGGGGGAGGGCCCATGGTGGG + Intronic
1145765710 17:27456976-27456998 GGAGGGGAAGCCTCCAAGGGGGG - Intronic
1152252577 17:79219627-79219649 GGTGGGGGAGGCTGCAGAGTGGG + Intronic
1152462613 17:80449444-80449466 GGTGGGGGAGGCTGCACGGTTGG + Intergenic
1152629812 17:81405860-81405882 GTTGGGGGAGACTCTCCGGTGGG - Intronic
1157716170 18:49888863-49888885 GGTGGGGTTGCCCCCACGCTTGG + Intronic
1157764594 18:50286895-50286917 GGGGGATGAGCCGCCACGGTGGG - Intronic
1159684606 18:71402541-71402563 GGTGTGGGAGCCCCCATGATGGG + Intergenic
1160339882 18:78080550-78080572 GGTGGGGACCCCTCCACGCTCGG + Intergenic
1160543439 18:79638025-79638047 GGTGGGGGAGGCTCCCTGGACGG - Intergenic
1160731662 19:644070-644092 GATGGAGGAGCATCCAGGGTGGG + Intergenic
1161457085 19:4374893-4374915 GGTGAGGGAGCCCCCACCATTGG - Intronic
1162789857 19:13057218-13057240 GGTGGGGGAGGCTCCACCCGAGG - Intronic
1162970788 19:14180100-14180122 CTTGGGGGAGCCTCTATGGTTGG + Intronic
1163149216 19:15401232-15401254 GGTGGGGGCGCCTTCCCGGGCGG - Exonic
1163188504 19:15658412-15658434 GGGGGAGGAGCCTCCTGGGTAGG + Intronic
1167086131 19:47310857-47310879 GGATGGGGACCCTCCATGGTTGG + Intronic
925451455 2:3973059-3973081 GGTGGTGGAGCCCACACTGTGGG + Intergenic
926086464 2:10023287-10023309 GGTGGGGCAGCCTGCACAGGAGG - Intergenic
926982164 2:18584309-18584331 GGTTGGGGCTCCTCCAGGGTAGG + Intronic
929235261 2:39598336-39598358 GCTGGGGAAGCCTGCACAGTGGG - Intergenic
929789062 2:45010523-45010545 GGTGGTGGGGCTTCCCCGGTGGG + Intergenic
932632902 2:73361956-73361978 GGTGTGGGACCCTCCATGGTGGG + Intergenic
933899042 2:86836131-86836153 GGTGGGGGAGCCAGCAGGGGAGG + Intronic
935210898 2:100938683-100938705 CATGAGGGAGCCTCAACGGTGGG - Intronic
938072833 2:128317528-128317550 GGTGGGGGAGCTGCCAGGGAAGG - Intronic
944235098 2:197435177-197435199 GGTGGGGGAGGAGACACGGTTGG + Intergenic
944386399 2:199169739-199169761 GGAGGGGTAGCCTCCACTGCCGG + Intergenic
945448842 2:209970183-209970205 GGTGGCGGAGCCTGCACAATTGG + Intronic
948332407 2:237180069-237180091 AGTGGGGAAGCCTCCATGGATGG + Intergenic
948578799 2:238970541-238970563 GGAGGGAGAGCCTCCACCGATGG - Intergenic
1169426987 20:5504316-5504338 AGCGGGGGAGCCTCCGCGGATGG - Intergenic
1173001660 20:39109766-39109788 GCTGGGGGAGCCTCCAGGGCCGG + Intergenic
1173712917 20:45176192-45176214 GGTGGGGAAGCATCCCAGGTTGG + Intronic
1175973374 20:62698447-62698469 GGAGGGGGAGCAGCCACGGAGGG + Intergenic
1176172334 20:63701622-63701644 GGTGGGAGAACCTCCAGGGCTGG + Intronic
1177834039 21:26170520-26170542 GCGGGGGGAGGCTGCACGGTGGG - Intronic
1178488855 21:33035298-33035320 GTTGGGGGAGCCTCAGCTGTGGG - Intergenic
1180084439 21:45501642-45501664 GGTGGTGGGGCCTCCACAGCCGG + Intronic
1181714219 22:24712528-24712550 GGTGGGGGAGACTCCATTCTTGG + Intergenic
1181745472 22:24952755-24952777 GCTGGCGGTGGCTCCACGGTAGG + Intronic
1181799322 22:25334098-25334120 GCTGGGGCAGCCTCCAGGATTGG - Intergenic
1182029978 22:27151031-27151053 GGTGGGGGAGGTTCCATGCTTGG + Intergenic
1182368764 22:29796506-29796528 GGTAATGGAGGCTCCACGGTAGG + Intronic
1182996444 22:34817136-34817158 GGTGTGGGACCCTCCAAGCTAGG - Intergenic
1184108870 22:42383774-42383796 GTTGGGGCAGCCCACACGGTGGG + Exonic
1184602862 22:45553744-45553766 GGAGGGGGAGCCTCCAGGGGAGG + Intronic
1184910126 22:47526263-47526285 GGTGGAGGAGCCCCTAGGGTGGG + Intergenic
1185031369 22:48444945-48444967 GGTGGCAGAGCCTCCATGGGTGG - Intergenic
1185210724 22:49569239-49569261 GGTGGAGGGGCCTGCAGGGTTGG - Intronic
1185220732 22:49627976-49627998 GGCGGGGGGGCCCTCACGGTCGG + Intronic
950134984 3:10574818-10574840 GGGGTGGGAGACTGCACGGTAGG + Intronic
952701656 3:36335330-36335352 GGTGGGGGAGGGTCCCCTGTGGG - Intergenic
954705683 3:52479336-52479358 GATGGGAGAGCCTCCTGGGTAGG - Intronic
960639805 3:119814257-119814279 GGTGGGGGCCCCTCCCAGGTTGG + Intronic
961330624 3:126135914-126135936 GGTGAGGGAGCCTGCACGGATGG - Intronic
961433646 3:126901224-126901246 GGTGGTGTAGCCTACATGGTCGG + Intronic
962159197 3:132980987-132981009 GGTGGGGGAGACTTCATGGGTGG - Intergenic
967986010 3:195095743-195095765 GGTGGGGCAGCCTTCACTGGAGG + Intronic
968452207 4:681030-681052 GGTGCAGGAGCCTTCTCGGTGGG - Intronic
969345385 4:6566727-6566749 GTTGGGGGAGTCTCCTGGGTTGG - Intergenic
972025712 4:34374444-34374466 GGAGGGGGAGCCTCCCGAGTTGG - Intergenic
973800646 4:54474580-54474602 GGTGGGGGAGCCACCACTCCAGG - Intergenic
981440336 4:144775329-144775351 GGTGGGGCAGCCTCCCCTCTAGG - Intergenic
985731084 5:1549274-1549296 GGTGGGGCTGCCTGCACGGGTGG + Intergenic
988534854 5:32057995-32058017 AGTGGGGGAGCCTCAGCGGGAGG + Exonic
990286974 5:54310252-54310274 GGAGGGGCAGCCTCCAGGGCGGG - Intronic
997418967 5:133750924-133750946 GGTGGGGGAGGCTGCTCAGTGGG - Intergenic
998220648 5:140275812-140275834 GGTGGGGAAGCATACTCGGTGGG + Intronic
1002010137 5:176272795-176272817 GGTGTGGGACCCTCCAAGCTAGG - Intronic
1002871090 6:1167816-1167838 GGTGGGAGAGCCCCCGCGGCGGG - Intergenic
1004262240 6:14118208-14118230 GGTGGGGGAGGCGCGACGGGAGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1019487739 7:1297032-1297054 GATGGGGGGGCTTCCACGCTGGG + Intergenic
1019890704 7:3943559-3943581 GGTCAGGGAGCCTCCGCGCTAGG - Intronic
1020001601 7:4759299-4759321 GACGGGGGAGCCTGCACGGAGGG - Exonic
1021355805 7:19651926-19651948 GGTGGGGGCGCCTTCTCTGTGGG - Intergenic
1023054869 7:36283362-36283384 GGAGGGGAAGCCTCTGCGGTGGG - Intronic
1024085611 7:45889335-45889357 GGTGGGGCTGCCTCCGCAGTTGG + Intronic
1024758176 7:52561733-52561755 GGTGGGTGAGACTCAAAGGTGGG + Intergenic
1026968382 7:74454159-74454181 GCTTGGGGATCCTCCAAGGTAGG + Exonic
1032285351 7:130535335-130535357 GGTGGAGGGGCCTCCAGGGAAGG + Intronic
1035371040 7:158379119-158379141 GGTGGGAGAGCCCCCAGAGTGGG + Intronic
1036645463 8:10609318-10609340 GGTGCTGGAGCCTCCAAGGGAGG - Exonic
1039913315 8:41841902-41841924 GCTGGGGGAGTCCCCACGGCAGG - Intronic
1042355001 8:67817783-67817805 GGAGGGGGAGCTTCCAGGGTGGG - Intergenic
1047974060 8:130112117-130112139 AGAGGGGGAGCCTCCGTGGTTGG + Exonic
1049041678 8:140116793-140116815 GGTGGGGCAGCAGCGACGGTGGG + Intronic
1049242444 8:141544849-141544871 GTTGGGGGAGCCTGCTGGGTCGG - Intergenic
1049624837 8:143615291-143615313 GGTGGGAGCTCCTCCAGGGTGGG - Intronic
1050011190 9:1187369-1187391 GGTGTGGGAGCCTCCAAGACAGG + Intergenic
1050906399 9:11011915-11011937 GTGGGGGGAGCGGCCACGGTGGG + Intergenic
1056955127 9:91075345-91075367 GGAGGAGGAGCCACCACGCTGGG - Intergenic
1057354727 9:94323808-94323830 GGTGGTGGAGCCTGCACAGGGGG - Intronic
1057653031 9:96933827-96933849 GGTGGTGGAGCCTGCACAGGGGG + Intronic
1060207027 9:121688127-121688149 GGTGGGGGAGCCTGCATGTCAGG + Intronic
1060743349 9:126113898-126113920 GGTGGGGGTGCCTGCTGGGTGGG + Intergenic
1062070965 9:134554794-134554816 GGGGGTGGAGCCTCCATGGCTGG - Intergenic
1062479323 9:136744175-136744197 TGTGGAGGAGCCTCCATGGTGGG - Intronic
1062503235 9:136860145-136860167 GGTGGGGGCTCCTCCCCGGGGGG - Intronic
1062636118 9:137492670-137492692 GGTGGGTGAGGCTCCAGGATGGG + Intronic
1199324120 X:146476831-146476853 GGTTGGGGAGCCTCCATGCCGGG + Intergenic
1202064593 Y:20925270-20925292 CGTGGGGGTGCCTCCCCGTTAGG + Intergenic