ID: 903122668

View in Genome Browser
Species Human (GRCh38)
Location 1:21226367-21226389
Sequence CTCCTTTTACAGACAAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903122662_903122668 12 Left 903122662 1:21226332-21226354 CCTCCCAATCACCACGGGAGGGT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG 0: 1
1: 0
2: 5
3: 22
4: 234
903122666_903122668 1 Left 903122666 1:21226343-21226365 CCACGGGAGGGTGGAACCATCAC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG 0: 1
1: 0
2: 5
3: 22
4: 234
903122664_903122668 9 Left 903122664 1:21226335-21226357 CCCAATCACCACGGGAGGGTGGA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG 0: 1
1: 0
2: 5
3: 22
4: 234
903122665_903122668 8 Left 903122665 1:21226336-21226358 CCAATCACCACGGGAGGGTGGAA 0: 1
1: 0
2: 1
3: 6
4: 81
Right 903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG 0: 1
1: 0
2: 5
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903122668 Original CRISPR CTCCTTTTACAGACAAGACA TGG Intronic
900951202 1:5859119-5859141 CTTGCTTTACAGACCAGACACGG + Intergenic
901094138 1:6664771-6664793 CTCATTTTACAGAAGAGAAAAGG + Intronic
901203388 1:7479473-7479495 CTCTTTTTCCAGACATGCCAGGG + Intronic
902589589 1:17464102-17464124 CTGCTTTTAGAGACAATAAATGG + Intergenic
903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG + Intronic
903171036 1:21553850-21553872 CACCTATTACAGACCAGGCATGG - Intronic
904267980 1:29328793-29328815 TCCATTTTAGAGACAAGACATGG + Intergenic
905544762 1:38788868-38788890 CTCCTTTTGCAGGAAAGAGATGG - Intergenic
907999113 1:59663189-59663211 CTCATTTTACAGACAAGGGGAGG + Intronic
908158139 1:61377752-61377774 CTCCTGCGACAGACAAGATAAGG + Intronic
909482533 1:76141265-76141287 CTCCATTTCCAGAAAAGAGAGGG + Intronic
909496136 1:76280789-76280811 CTCATTTTATAGAAAAGAAAAGG - Intronic
913169196 1:116217095-116217117 CTCCTTGTACATAAAAGACTGGG - Intergenic
913210480 1:116578221-116578243 CTTATTTTACAGAGAAAACAGGG - Intronic
913310878 1:117491361-117491383 TTCCATTTACAGACCACACAGGG - Intronic
917472819 1:175340522-175340544 CTTTTTTTGCAGACAAGAGAAGG + Intronic
917644284 1:177014724-177014746 CTCCTTACACAGACATGACGTGG - Intronic
917702842 1:177598642-177598664 CTTATTTTACAAATAAGACATGG + Intergenic
919355164 1:196513002-196513024 CTCCTTTTTCAGACACGATAAGG - Intronic
919842507 1:201619508-201619530 CTCATTTTGCAGACTGGACATGG + Intergenic
920515536 1:206582223-206582245 CACCTTGTAGAGACAATACAGGG - Intronic
922563123 1:226583329-226583351 CTCTTTTAACAGACAAGAACAGG - Intronic
923142582 1:231173518-231173540 CACATTTCACAGAGAAGACAAGG + Intronic
923764055 1:236876003-236876025 GACCTTTAAGAGACAAGACAAGG - Intronic
923905017 1:238375048-238375070 CTAATTTTACAGATAAAACAGGG + Intergenic
924884560 1:248200398-248200420 CTCCTCTTGAAGACAACACAAGG + Intergenic
1063535388 10:6877708-6877730 AGGCTTTGACAGACAAGACAGGG + Intergenic
1065722915 10:28643457-28643479 CTTCTTCTACTCACAAGACAGGG - Intergenic
1065936910 10:30528694-30528716 CTCCCTAGAGAGACAAGACAAGG - Intergenic
1066111197 10:32198629-32198651 TTCATTTTACAGACAAGGAATGG + Intergenic
1068140014 10:52993929-52993951 CTCCTTTTAATGTCAAGAAAAGG - Intergenic
1068539031 10:58270701-58270723 TTTCTTTTTTAGACAAGACAAGG + Intronic
1069116390 10:64511674-64511696 CTCCTTTTAAAGAGCACACATGG - Intergenic
1070039573 10:72762490-72762512 CTCTTTTTATTAACAAGACAAGG - Intronic
1070780755 10:79136195-79136217 CTCATTTTACAGATAAGAAAAGG - Intronic
1071963964 10:90833448-90833470 CTCCTTTTACAAATAAGGAAAGG - Intronic
1073838742 10:107473982-107474004 TCCATTTTAGAGACAAGACATGG + Intergenic
1074541278 10:114367181-114367203 CTCCTGTTACACAGAAGAGATGG - Intronic
1075757712 10:124828068-124828090 CTCCTTCTACAGACAACCCAAGG - Intronic
1076881831 10:133243448-133243470 CTCCGGTTACAGAGAGGACAAGG - Intergenic
1077261459 11:1623665-1623687 CGCCTCTTCCAGATAAGACAAGG - Intergenic
1078543840 11:12232000-12232022 CTCATTTTTCAGACAAGCAAAGG - Intronic
1078724501 11:13917574-13917596 CTCCTTTTACATGTAAAACATGG - Intergenic
1079060318 11:17243043-17243065 CTCATTTTACAGGGAAGAAAAGG - Intronic
1079417967 11:20257946-20257968 CTCATTTTACAAATAACACAAGG + Intergenic
1079451566 11:20603464-20603486 CCTCTTTTACAGATGAGACACGG + Intronic
1079722909 11:23841899-23841921 CTCCTGTTAAAGAAAAGCCAAGG - Intergenic
1079840744 11:25396398-25396420 ATCCTTGTACAGATAAGCCAAGG - Intergenic
1081871229 11:46383457-46383479 CTTGTTTTACAGCCAAGAAAGGG + Exonic
1083437310 11:62651555-62651577 CCCATTTTACAGACAAATCAAGG + Intronic
1085390624 11:76180323-76180345 CTCATTTTACAGCCAAGGAAAGG + Intergenic
1086267818 11:85022601-85022623 CTTTTTTTACAGACAAAACGTGG - Intronic
1087156228 11:94907562-94907584 TTCCATTTACAGAGAAGACGAGG + Intergenic
1088145097 11:106667535-106667557 CTCTTTTTTAAGACAAGATAAGG - Intergenic
1088904553 11:114144509-114144531 CTTCTTTTACAAAAAAGAAAAGG + Intronic
1089822345 11:121240049-121240071 CTTCTTTTACAAAAAAGAGAAGG + Intergenic
1089927046 11:122269483-122269505 CCCATTTTACAGACGAGAAATGG - Intergenic
1089933311 11:122336565-122336587 GTCCTTTTATAGAGAAGCCACGG - Intergenic
1090276433 11:125423206-125423228 CGCCGGTTAGAGACAAGACAAGG + Intronic
1090528316 11:127561718-127561740 CTGCTTTTACCAACAAGGCAAGG - Intergenic
1091716313 12:2779144-2779166 CTCCTATCACAGACAAGCCCAGG - Intergenic
1091843953 12:3640960-3640982 CTCCTTTTACAGACAAGGCTAGG - Intronic
1092854599 12:12661254-12661276 CTCATTTGACAGAGAAGCCAAGG - Exonic
1097658089 12:62394058-62394080 ATCTTTTTACAGACAAGATCAGG - Intronic
1100226839 12:92566095-92566117 CTCATTTTACAGACGAGAAACGG - Intergenic
1100318783 12:93470329-93470351 CTCTGTTTACAGACAGGAAAAGG - Intronic
1101448245 12:104753767-104753789 CTCTTTCTACAGGCAAGGCAGGG + Intronic
1102414578 12:112749405-112749427 CTCCTTTTACAGATGAGAGCTGG - Intronic
1104124705 12:125835350-125835372 CTCATTTTACAAATAAGAGAGGG + Intergenic
1104337596 12:127914393-127914415 CACCTTTTACAGAAAAGAGCTGG - Intergenic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1105640887 13:22262972-22262994 TGTCTTTTACTGACAAGACAAGG - Intergenic
1106418223 13:29563847-29563869 CTCCTGTCACAAAAAAGACAGGG + Intronic
1107972483 13:45656955-45656977 CTCTTTCTACAGAAAACACATGG - Intergenic
1109606498 13:64704742-64704764 CTTCTTTTACAAAAAAGAGAAGG - Intergenic
1109914288 13:68960215-68960237 CTCCTTCCACTGCCAAGACATGG - Intergenic
1110151073 13:72254082-72254104 GTCCTTTAGCAGACACGACACGG - Intergenic
1112595537 13:100804010-100804032 CTCATTTTATAGACCATACAGGG - Intergenic
1112618107 13:101026372-101026394 CTCCTTTTACAGAAGAGAAAAGG + Intergenic
1114479710 14:23025161-23025183 CTTCTGTTAAAGAGAAGACAGGG - Intronic
1115196380 14:30804913-30804935 CCCCCTTTACTGACAAGACAGGG - Intergenic
1118283699 14:64451994-64452016 CTCCTTTTAAAAACAAAACTTGG + Intronic
1119573118 14:75693935-75693957 CTCATTTTAAAGATAAGACTAGG + Intronic
1119715100 14:76853553-76853575 CTGCATTTACAGTCAAGAGATGG - Intronic
1120747249 14:88163699-88163721 CTCTTTTTACAGTCACGATATGG + Intergenic
1124157462 15:27238529-27238551 CTCCTGTTACAGAATAGAGAAGG - Intronic
1125306132 15:38317309-38317331 CTTCTTTGTAAGACAAGACATGG - Intronic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1127389750 15:58495978-58496000 CTTCTTTTCCAGATAAGAAAAGG + Intronic
1128327392 15:66733931-66733953 CTCATTTTACAGAACTGACAGGG + Intronic
1128824276 15:70697078-70697100 CTTCTTTTAAAAACAAGACATGG + Intronic
1129127535 15:73456780-73456802 CAGATTTTACAGACAAGAAAAGG - Intronic
1129696517 15:77743335-77743357 CTCCTTTTACAGAGTACATAGGG - Intronic
1130805139 15:87313211-87313233 CTGCTTTTAAAGCCAAGAAAAGG + Intergenic
1132635025 16:939916-939938 CCCCTTTTCCAAATAAGACAGGG - Intronic
1134071812 16:11264957-11264979 CCCATTTTACAGAAAAGACCAGG + Intronic
1134368804 16:13604606-13604628 CAACTTTTACAGACAAAAGAGGG - Intergenic
1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG + Intergenic
1140706479 16:77635148-77635170 CTCCTTTTATAGAGAGCACAGGG + Intergenic
1142888060 17:2925640-2925662 CTCCTCTTAGAGAAAAGGCAGGG - Intronic
1143217860 17:5238659-5238681 CTCCCTTCATACACAAGACACGG - Intergenic
1147705975 17:42424997-42425019 CTCATTTGACAGACAGGAAAAGG + Intergenic
1149923532 17:60680477-60680499 TTCCTTTTATAGATAACACATGG - Intronic
1150276412 17:63900626-63900648 CTGTTTTTGCAGACAAGCCATGG + Intergenic
1150936232 17:69638671-69638693 CTCCTCTTACAGTCAGGACATGG + Intergenic
1152501946 17:80717985-80718007 CTCCTTTTGCAAAGAAGAAAAGG - Intronic
1152804117 17:82347041-82347063 CTGCTTTTAAATACAAGAGATGG + Intergenic
1154247320 18:12710655-12710677 CTCCAGTTACAGAAAACACAGGG - Intronic
1156201758 18:34841115-34841137 CCCCTTTTATAGACAAGTAAAGG + Intronic
1156803530 18:41148070-41148092 CACCTTTTAAAAGCAAGACAAGG - Intergenic
1157427009 18:47592753-47592775 GTACTTTTACAGACAGGTCAAGG + Intergenic
1158915551 18:62123407-62123429 CTTCTTTTTCACTCAAGACATGG - Intronic
1160125923 18:76171344-76171366 CCCATTTTACAGACAGGACATGG - Intergenic
1160381233 18:78457678-78457700 CTGCTTTTACATAGAAGGCAAGG - Intergenic
1161788711 19:6345196-6345218 CTTCATTTACAAACAACACACGG - Intergenic
1163434623 19:17288077-17288099 CTGCTTTTACCGCCCAGACATGG + Intergenic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166902705 19:46078030-46078052 CTCATTTAAGAGACAAGAGAAGG + Intergenic
1166939295 19:46353132-46353154 CTCATTTTACAGACAAGCCATGG - Intronic
925037468 2:701038-701060 CTTCATTTACAGATAACACATGG + Intergenic
925659851 2:6190863-6190885 CTCTCTTTACAGACAAGCAAAGG - Intergenic
927666118 2:25034061-25034083 CTACTACTACATACAAGACACGG - Intergenic
930843203 2:55871247-55871269 CTGCTTTTAGACACAAGACTGGG + Intronic
931769808 2:65487742-65487764 CTACTTTTCAAGCCAAGACATGG - Intergenic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
932657124 2:73619884-73619906 CTGGCTGTACAGACAAGACAGGG - Intergenic
933278645 2:80308420-80308442 TTCCTTTTAAAGAAAAGCCATGG - Intronic
935641414 2:105294112-105294134 CTCATTTCACAGACAAGACATGG - Intronic
936434008 2:112487636-112487658 CCCATTTTACAGATGAGACACGG - Intronic
936465195 2:112741960-112741982 TTTTTTTTAAAGACAAGACAGGG + Intronic
936667765 2:114616985-114617007 CTCCCTTTACAGGAAATACAAGG + Intronic
938636362 2:133231116-133231138 CTCATTTTAGTGACAAGAAATGG + Intronic
939093176 2:137802126-137802148 CACCTTTTAAACTCAAGACAGGG + Intergenic
941305174 2:163855818-163855840 TTCCTTTTACAGAAAATTCAAGG + Intergenic
942825731 2:180173130-180173152 CTCCTATTAAAGAAAAGACTAGG + Intergenic
944972545 2:205010709-205010731 CTCTTTTTACATTCCAGACATGG + Intronic
945135134 2:206618908-206618930 CTCCTTTCACATTAAAGACAGGG - Exonic
945170956 2:206994452-206994474 CTCTTTTTACAGATCAGAAAGGG - Intergenic
946710973 2:222504827-222504849 CAGCTTTTACAGTCATGACAAGG + Intronic
1169595427 20:7193092-7193114 CTCCATTTCCAGTCTAGACAAGG + Intergenic
1170523084 20:17208705-17208727 CTTCTTTGATAGACAAGAAAGGG + Intergenic
1171082979 20:22207411-22207433 CTCCTCTTACAGAATAGAGATGG - Intergenic
1174138528 20:48397288-48397310 CTCCGTCTGCAGACAAGCCAAGG - Intergenic
1174619317 20:51862202-51862224 CTCTATTTACAGAGAAAACAGGG + Intergenic
1175346576 20:58282516-58282538 TTCAGTTTACAGAAAAGACAGGG + Intergenic
1177268837 21:18819958-18819980 TTCCTTTTAAACACAAGCCATGG + Intergenic
1177368157 21:20166221-20166243 TTCATTTTACAGACAAGTCGGGG + Intergenic
1177928603 21:27250455-27250477 TTCTTTTTTGAGACAAGACAGGG - Intergenic
1178725590 21:35048713-35048735 TTCCTCTCACAAACAAGACAGGG + Intronic
1179625750 21:42648759-42648781 CTCCTTTTGCACAAAAGTCAAGG + Intergenic
1183305610 22:37081540-37081562 CTCGTTTCACAGACAAGGAAGGG + Intronic
1183309443 22:37101501-37101523 CTCCTCTTCCAGACAGGGCAGGG + Intronic
1183734479 22:39636251-39636273 CTCCTTTTGCAGCCGAGACAGGG - Intronic
1185345879 22:50310375-50310397 CCCATTCTACAGACAAGACGCGG - Exonic
950630685 3:14279814-14279836 CTCATTTAACAGAGAAGCCAGGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
955510290 3:59673370-59673392 CTCCTTTTAGAGATAATGCATGG - Intergenic
956099819 3:65756151-65756173 CCCCTCTTACAGAGAAGAAAAGG + Intronic
956927126 3:74001712-74001734 TTCCTTCTACAGGCAAGACTGGG + Intergenic
958786592 3:98603324-98603346 CTCCTTTTCCAACCAAGAAAGGG + Intergenic
960146181 3:114206102-114206124 TTCCTTTCACAGAGAAGAAATGG + Intergenic
961538497 3:127584806-127584828 TTCTTTTTAAAGACAAGTCAGGG - Intronic
962473607 3:135736730-135736752 CTCATTTAACAGACAAAACAAGG - Intergenic
963981245 3:151539566-151539588 CTCTTTTTACAGTTAAGAAATGG + Intergenic
965428945 3:168562959-168562981 CTCCTTTTTCAGCCAATAGATGG + Intergenic
966216042 3:177503769-177503791 CTCCTCTAACAGTCAAGAGAAGG - Intergenic
967971065 3:194999802-194999824 CTCTTTTTAAAAACATGACATGG - Intergenic
968560872 4:1281144-1281166 CTACTTTTACTGACAAGTAAGGG - Intergenic
969026510 4:4177379-4177401 ATGATTTTACAGACAAGAAAAGG - Intergenic
969481093 4:7447320-7447342 CTCTCTTTACACACAAGGCAAGG - Intronic
970401265 4:15719944-15719966 CCCCTTTTAAATACAAAACAAGG + Intronic
970914133 4:21312533-21312555 CACCTTTTACAAACTTGACATGG + Intronic
971072443 4:23110254-23110276 CTCCTCTTCCAAACAAGAGAAGG - Intergenic
971830602 4:31687708-31687730 ATGCCTTTAGAGACAAGACAAGG - Intergenic
971931006 4:33082710-33082732 GCCCTTTTACAGAAAAGAGATGG - Intergenic
973312452 4:48724212-48724234 CTAGTTTTACATAAAAGACAGGG + Intronic
973832933 4:54779986-54780008 CTCCTTTTACAAACAAGAAAAGG + Intergenic
974211710 4:58785481-58785503 TTCCTTTTACAGAGAAAACCAGG - Intergenic
975709960 4:77151187-77151209 CTCCTTTTACAAACCAGCCTTGG - Intergenic
976049251 4:80991799-80991821 TTCCTTTACCAGACAAGAAAAGG - Intergenic
977228922 4:94428372-94428394 CTACATATACACACAAGACAGGG + Intergenic
979300735 4:119084069-119084091 CTCATTTTACAGAAAGGAAATGG + Intergenic
983101054 4:163626226-163626248 ATCCATTTATAGACAACACAAGG + Intronic
983642332 4:169954688-169954710 CTCCTTTAACAAACACAACATGG + Intergenic
990965161 5:61438502-61438524 CTTCTGTTACAGACAACACCAGG + Intronic
992217800 5:74543059-74543081 CTCCTTTTATAGAAAAGCGAGGG - Intergenic
993393308 5:87349635-87349657 CTCCTCCTACAGATAACACATGG - Intronic
994600294 5:101894157-101894179 CTGTTTTTACGGGCAAGACAGGG + Intergenic
994653730 5:102562532-102562554 CTCCTTAAATAGACAAGGCAAGG + Intergenic
994849239 5:105033455-105033477 CTCCTTGTACAGTCTAGATATGG - Intergenic
996157790 5:120124061-120124083 CTCCTATCTCAGACAAGACAGGG + Intergenic
997598823 5:135125761-135125783 CCCATTTTACAGAAAAGAGATGG + Intronic
998032876 5:138888021-138888043 CTAATTTTACAGACAAGAAATGG - Intronic
998738072 5:145165923-145165945 TTCATTTCACAGACAAGACAAGG + Intergenic
1000794115 5:165643712-165643734 CTCCTTTTCTACCCAAGACAAGG + Intergenic
1001329314 5:170751372-170751394 CCCCTTTTACAGATGAGAAAGGG + Intergenic
1002327891 5:178421566-178421588 CTCCATTAACAGAGCAGACAGGG + Intronic
1004043570 6:12006557-12006579 ATCCTTCTAAAAACAAGACATGG + Intergenic
1004556264 6:16701411-16701433 ATTCCTTTACACACAAGACAGGG + Intronic
1004775455 6:18839464-18839486 CTCATTTTACAAACAAGTAAAGG - Intergenic
1006828675 6:36955546-36955568 CGCCTTTTACAGATGAGACACGG - Intronic
1007052364 6:38845433-38845455 GTCATTTTACAGCCAAGAAAAGG - Intronic
1007527727 6:42511480-42511502 CTCATTTTACAGACAAGAGAAGG + Intergenic
1007959768 6:45948063-45948085 CTCATTTCACAGTCAGGACAGGG - Intronic
1010296662 6:74206615-74206637 CTCTGGTTACTGACAAGACATGG - Intergenic
1012541351 6:100365920-100365942 CCCATTTTACAGACAGGAAATGG + Intergenic
1013357835 6:109362365-109362387 CTCCTTTTATACACAAGGCTGGG + Intergenic
1014266115 6:119279625-119279647 ATCCTGTTAAATACAAGACAAGG - Intronic
1016057092 6:139589649-139589671 TTCTTTTTACAAACATGACAAGG + Intergenic
1017565668 6:155683140-155683162 TCCATTTTACAGAGAAGACAAGG + Intergenic
1017649109 6:156564877-156564899 CTCATTTTACAGAAGAAACAAGG + Intergenic
1018266759 6:162032707-162032729 CTCCTTTTTCAGAGAAAGCATGG + Intronic
1021112594 7:16712656-16712678 CTACTTTTCCAGAGAAGACACGG - Intergenic
1022241644 7:28518081-28518103 CTCATTTTACAGAGAGGACTGGG - Intronic
1022979966 7:35595118-35595140 CTCCTTTTTCAGCAAAGAGAGGG - Intergenic
1024725574 7:52189901-52189923 CTCCTTTATGAGACAAGAAAGGG - Intergenic
1026730877 7:72910841-72910863 CTGCTCTAACAGATAAGACAGGG + Intronic
1026852750 7:73735350-73735372 CACCTCTTCCAGACAAGACTTGG + Intergenic
1027250530 7:76396002-76396024 CCCCTCTTACAGAGAAAACAGGG + Intronic
1027607632 7:80319984-80320006 CTCCTTTTACAGAGAAAACTAGG - Intergenic
1027696397 7:81416417-81416439 CTCCTTTTACACACCACACTTGG + Intergenic
1027948901 7:84786875-84786897 ATCATTTTATAGACAAAACATGG + Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1029445596 7:100611011-100611033 CTCCTTTTACAGCCTGGATAAGG - Intergenic
1030059466 7:105611278-105611300 CTGCCTTTGCAGACTAGACAGGG - Intronic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1033444431 7:141407985-141408007 CTCCTTTTCCAGAAAAGGAATGG + Intronic
1035173169 7:157031955-157031977 CTCCATTTACAGATAAGATAAGG - Intergenic
1040658368 8:49540269-49540291 GTCCTTTAACAGAAAAAACAAGG + Intronic
1041586736 8:59529330-59529352 CTCCATTTACTGACAGCACAAGG - Intergenic
1042295215 8:67210585-67210607 CTACTTTTGCAGACAGAACATGG + Intronic
1042708674 8:71690719-71690741 CTTGTTTTACAGACTTGACATGG - Intergenic
1044016621 8:87054064-87054086 CTCCATTCACAGATAAGACATGG + Intronic
1044762880 8:95540434-95540456 ACCATTTTACAGACAAGAGAGGG - Intergenic
1047215793 8:122874978-122875000 CTCATTTTACAGTCAAGGAAAGG - Intronic
1051210830 9:14741301-14741323 CTGCTTTTCCAGACTAGATATGG + Intronic
1051310164 9:15762312-15762334 CTCCTTTTCCAGAAAAAATATGG + Intronic
1054865904 9:70000683-70000705 ATCATTTTTCAGACAAAACATGG + Intergenic
1055678951 9:78694901-78694923 CTACCTTTACAGTCAGGACATGG - Intergenic
1057169703 9:92954335-92954357 CTCATTCTTCTGACAAGACAGGG - Intronic
1057908008 9:98997218-98997240 CTCATTTTACAGACAAGAGGAGG + Intronic
1059167947 9:112096979-112097001 CTGCTGATACAGACAGGACAAGG + Intronic
1061514432 9:131080587-131080609 TTCCTTTTAAAGACAGGATAAGG + Intronic
1061568092 9:131457652-131457674 CTCCTTTTCCAGACCATCCATGG + Intronic
1061599262 9:131655970-131655992 CTCATTTTCCAGACAAAATAAGG - Intronic
1061959959 9:133982882-133982904 CTCCGTTTACAGACCACCCAGGG + Intronic
1062676669 9:137749817-137749839 CTTATTTTAAAAACAAGACAAGG - Intronic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1186061827 X:5717046-5717068 CTCCTCTTATAAACAATACATGG + Intergenic
1188963974 X:36527864-36527886 ATTATTTTACAGATAAGACAAGG - Intergenic
1190688538 X:52894976-52894998 CTCCTATTACAGATGAGGCACGG - Intronic
1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG + Intronic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1194098773 X:89676043-89676065 AACCTTTTACAGACAAGCAAAGG + Intergenic
1194269108 X:91787990-91788012 TTCATTTTACAGATAAGAAAAGG + Intronic
1195228936 X:102826588-102826610 CTCCTTTTACAGATAACTAAGGG - Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1197289839 X:124641941-124641963 CTCCTTTTACACAGATGCCATGG + Exonic
1199803936 X:151279311-151279333 CTCCTTTTAATGACACAACAGGG + Intergenic
1200386065 X:155891991-155892013 GTCCTTTTAGAGGCAAGACTGGG + Intronic
1200451799 Y:3337416-3337438 AACCTTTTACAGACAAGCAAAGG + Intergenic
1200586326 Y:5008999-5009021 CTCATTTTACAGATAAGAAAAGG + Intronic