ID: 903125469

View in Genome Browser
Species Human (GRCh38)
Location 1:21244571-21244593
Sequence TGGGAAACCCCAGGCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903125469_903125478 22 Left 903125469 1:21244571-21244593 CCCACCTGGCCTGGGGTTTCCCA 0: 1
1: 0
2: 1
3: 29
4: 256
Right 903125478 1:21244616-21244638 AATAACACTGAACAGTCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 39
903125469_903125473 -10 Left 903125469 1:21244571-21244593 CCCACCTGGCCTGGGGTTTCCCA 0: 1
1: 0
2: 1
3: 29
4: 256
Right 903125473 1:21244584-21244606 GGGTTTCCCAGAATACAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 138
903125469_903125475 -6 Left 903125469 1:21244571-21244593 CCCACCTGGCCTGGGGTTTCCCA 0: 1
1: 0
2: 1
3: 29
4: 256
Right 903125475 1:21244588-21244610 TTCCCAGAATACAAACTGGGAGG 0: 1
1: 1
2: 4
3: 22
4: 290
903125469_903125474 -9 Left 903125469 1:21244571-21244593 CCCACCTGGCCTGGGGTTTCCCA 0: 1
1: 0
2: 1
3: 29
4: 256
Right 903125474 1:21244585-21244607 GGTTTCCCAGAATACAAACTGGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903125469 Original CRISPR TGGGAAACCCCAGGCCAGGT GGG (reversed) Intronic
900487278 1:2929155-2929177 TGGGCCACCCCAGGCCACCTTGG - Intergenic
900639537 1:3682130-3682152 CTGGAAACCGAAGGCCAGGTGGG - Intronic
900962954 1:5937262-5937284 TGGCAAACCCCAGGTGTGGTAGG - Intronic
901078803 1:6572038-6572060 AGGGCAACCACAGGCCAGGCAGG - Intronic
901425944 1:9182511-9182533 GGGGAAACGCCAGCCCAGGCGGG - Intergenic
901435762 1:9246532-9246554 TGGGCAACTCCAGGCAGGGTGGG - Intronic
901801085 1:11708313-11708335 TGTGAAACCTCAGGCCAGGCTGG + Intronic
903006003 1:20299303-20299325 AGGAAAACCTCAGGCAAGGTTGG - Intronic
903125469 1:21244571-21244593 TGGGAAACCCCAGGCCAGGTGGG - Intronic
903282536 1:22258103-22258125 GGGGCAGCCGCAGGCCAGGTAGG + Intergenic
903818061 1:26079538-26079560 TGGGGAGCGGCAGGCCAGGTGGG - Intergenic
908521919 1:64952281-64952303 TGTGAAACCAAGGGCCAGGTTGG + Intronic
910842292 1:91572152-91572174 TTGGAAACCCCAGGCCAGAGAGG + Intergenic
911047287 1:93639099-93639121 TGGGAAGCCCCAGGGCTGTTGGG - Intronic
911064221 1:93773424-93773446 TGGGACACCCCTGTGCAGGTGGG + Intronic
913441078 1:118898393-118898415 TGGGAAACCTGTGGCCAGATGGG - Intronic
915461033 1:156070710-156070732 TGCCAACCCCCAGGGCAGGTGGG + Intergenic
915729266 1:158041639-158041661 TGGGAAAGCCCAAGCGAGGGTGG - Intronic
918926832 1:190797405-190797427 TGGGCAGCCCCAGGTCAGGAGGG - Intergenic
919918686 1:202155070-202155092 TAGGAAGCTCCAGGCCAGGTGGG - Intronic
920396322 1:205648693-205648715 AGGGATACCCCAGGCCAGAAGGG + Intergenic
920561906 1:206944973-206944995 TGTGAAAGCCCAGGGCAAGTGGG + Intronic
921038771 1:211408737-211408759 AGGGAAAACCCAGGCCTGGATGG + Intergenic
921346244 1:214188296-214188318 TGGGAAAACCCCAGCCAGGGAGG - Intergenic
922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG + Intergenic
922801101 1:228365124-228365146 TGGGACATCCCAGGGCAGGCAGG + Intronic
923492200 1:234493829-234493851 GTGGGCACCCCAGGCCAGGTAGG + Intergenic
1064395710 10:14980615-14980637 TGGGACACCCCAGGTCAGTCGGG - Intronic
1065420530 10:25538992-25539014 TGGGAAAACCGAGACCAGGGAGG + Intronic
1067048051 10:42996910-42996932 TGGGAAACTCCAGGCTTGGGTGG - Intergenic
1067184070 10:44012330-44012352 TGGGAAAGCCCTGCCCAGCTGGG + Intergenic
1069748657 10:70732029-70732051 TGGGAAACTGCAGGCCAAGAGGG + Intronic
1072197801 10:93131578-93131600 AGGGAAACGCCTGGGCAGGTGGG - Intergenic
1072294196 10:93993873-93993895 TGGGAAAGCCCGGCCCAGGGCGG + Intergenic
1074292861 10:112153729-112153751 TAGGACACCACAGGTCAGGTTGG - Intronic
1075444941 10:122506567-122506589 TTGGAAACACCAGGCCCGGTGGG - Intronic
1076922431 10:133461294-133461316 TGGGAGACCACAGGTCAGATGGG - Intergenic
1077093816 11:791021-791043 TGGCCAATCCCAGGCCAGGGTGG + Exonic
1077224437 11:1433928-1433950 TGGGTGAGCCCAGGCCGGGTGGG - Intronic
1078727407 11:13943922-13943944 TGGGAAACCCAAGGAGAGGTAGG + Intergenic
1081560400 11:44209181-44209203 TGGGATTCCCCAGTCTAGGTTGG + Intronic
1081868032 11:46370325-46370347 TGGGAAACCGCTGCCCAGCTTGG - Intronic
1083411021 11:62492425-62492447 AGGGAATCCCATGGCCAGGTGGG - Intronic
1083769823 11:64860402-64860424 TGAGAAATACCAGGCCAGGTTGG - Intronic
1084633470 11:70373095-70373117 TTGGAAAACACAGGCCAGGGAGG + Intronic
1084844421 11:71888099-71888121 TGGGACACCCCACGGCAGTTGGG + Intronic
1086506774 11:87513305-87513327 TGGGAAACACCCTGCCAGGCTGG + Intergenic
1088909619 11:114180810-114180832 TGGTAAAGCCCAAGACAGGTGGG + Intronic
1089004785 11:115082329-115082351 TGGGGGCCACCAGGCCAGGTGGG - Intergenic
1089194814 11:116688079-116688101 ATGGAATACCCAGGCCAGGTGGG - Intergenic
1089573149 11:119423108-119423130 CGGAAGACCCCAGTCCAGGTGGG - Exonic
1090804155 11:130192056-130192078 TGGGATACCCCACGTCAGGGTGG + Intronic
1092282881 12:7110555-7110577 AAGGAAACTCCAGGACAGGTAGG + Intergenic
1097276396 12:57816239-57816261 TGGTAATCCCCAGGCCAGCCAGG - Exonic
1101189955 12:102322369-102322391 TGGGATATCCCAGGCTGGGTTGG + Intergenic
1101448299 12:104754125-104754147 TGGGAAACTCCAGGCCAAGCTGG + Intronic
1102509341 12:113403702-113403724 TGGGAAACCACAGGCTAGCCCGG + Intronic
1103922644 12:124407082-124407104 TGTGAACCCCCAGCCCAGGGCGG - Intronic
1104274432 12:127312119-127312141 AAGGAAACCACAGGACAGGTGGG - Intergenic
1107113694 13:36724370-36724392 TTGGAAAACCCAGGGCATGTAGG - Intergenic
1107958439 13:45539499-45539521 TAGAAAACCCCAGGCCTGGCTGG - Intronic
1109835407 13:67850487-67850509 TGGGCATCCCCAGGCCACATTGG + Intergenic
1113001345 13:105641617-105641639 TGGGAGACCACAGGGCAGGCAGG - Intergenic
1113057100 13:106280696-106280718 TGTGAAATCCCAGGCCATGTGGG + Intergenic
1113513687 13:110874687-110874709 TGGGGAACCGCAGCCAAGGTTGG - Intergenic
1113914269 13:113861581-113861603 TGGGAGACCCCAGGCCCGAGGGG - Intronic
1114255255 14:20996240-20996262 TGAGAAGCTACAGGCCAGGTTGG - Exonic
1114667464 14:24387895-24387917 TGGGAAACCCCAAACCAGGCAGG - Intergenic
1115651465 14:35405065-35405087 TGGGAAACCCCAGGGAAAGAAGG - Intergenic
1115927887 14:38457291-38457313 TGGGAGGCCACAGGGCAGGTGGG - Intergenic
1118819796 14:69337830-69337852 TGAGAGCCCCCAGGCCTGGTTGG + Intronic
1119110284 14:71966500-71966522 TGGGAGACCCCGTGCCAGGCTGG + Intronic
1119647922 14:76361815-76361837 TGGGGAACTCCAGGGAAGGTGGG + Intronic
1120169543 14:81235255-81235277 TGGGAAAGCACAGACTAGGTGGG + Intergenic
1121036167 14:90705453-90705475 TGGGAACCCAGAGGCCGGGTGGG - Intronic
1121741278 14:96254047-96254069 TAGGACACCCCAGGGAAGGTTGG + Intronic
1122225825 14:100278710-100278732 CAGAACACCCCAGGCCAGGTTGG + Exonic
1123033154 14:105460583-105460605 TAGGAAAGGCCAGTCCAGGTGGG - Intronic
1123037299 14:105476730-105476752 TGGGACACACCAGGGCAGGCAGG - Intronic
1123044587 14:105505154-105505176 TGGGAAAAGCCAGCCCAGGAGGG + Intergenic
1124555191 15:30718982-30719004 TGGCAAACCCCAGGCTGGCTGGG - Intronic
1124676062 15:31686699-31686721 TGGCAAACCCCAGGCTGGCTGGG + Intronic
1125764382 15:42123496-42123518 TGGGAAACTCCAGCCCAGGGAGG + Intergenic
1128306813 15:66604190-66604212 TGGCAGCCCCCAGGCAAGGTGGG + Intronic
1128349670 15:66880553-66880575 TTAGAAACCCCTGGCCAAGTGGG - Intergenic
1129016020 15:72469647-72469669 TGGGAAGTCCCAGGCAAGCTGGG - Intergenic
1129411593 15:75353555-75353577 TGGGAAACCCATGGCCGAGTGGG + Intronic
1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG + Exonic
1132311732 15:100862351-100862373 GGGGAATCCCCAGGCCAGCAGGG + Intergenic
1132690674 16:1180628-1180650 CGGGAAAGCCAAGGCCAGGTGGG - Intronic
1132698950 16:1214127-1214149 TGGGACACTCACGGCCAGGTTGG - Intronic
1133301608 16:4786016-4786038 TGGGCACCCCCAAGCCCGGTGGG + Exonic
1136359564 16:29769929-29769951 TGGGAAACCTCAGGGCAGCTTGG - Intergenic
1138077350 16:54055953-54055975 TGGGGAACTTCAGGCCAGGAGGG - Intronic
1138504911 16:57473463-57473485 TGGGGCAGCCCAGGCCAGCTCGG - Exonic
1138973074 16:62170300-62170322 TGGGAAACCCCAGCCCAATTTGG - Intergenic
1139953869 16:70684405-70684427 TGGGTAGTCCCAGGCCAGGCTGG + Intronic
1141312535 16:82928789-82928811 TGGGAAACCACTGGAAAGGTTGG + Intronic
1141531450 16:84649097-84649119 TGGGAAACCCCCGGCCGGACGGG + Intronic
1141560563 16:84864984-84865006 TGGAGAACCCCAGCCCAGGAAGG + Intronic
1141623111 16:85247623-85247645 TGCTAAACCCCAGGACAGGCAGG - Intergenic
1141815733 16:86408200-86408222 TGGGAGACCAGAGGCCAGGGAGG + Intergenic
1141942784 16:87289486-87289508 TGGGAAAGCCCAGGGCATGGCGG + Intronic
1142137181 16:88456805-88456827 TGGGAGTCCCCAGGTCAGGCTGG + Intronic
1142997479 17:3769352-3769374 TGGGAACGCGCAGTCCAGGTGGG - Intronic
1143117750 17:4590292-4590314 TGAGAAAGCCAAGGCCAGGAAGG - Intronic
1144829698 17:18124359-18124381 AGGGAACCCCAAGGCCAGGTGGG - Intronic
1145865695 17:28240243-28240265 TGGGAATCCCAAGGCCAAGAGGG + Intergenic
1145959927 17:28881377-28881399 TGGGGGAGCCCAGGCCAGTTAGG + Intronic
1146288910 17:31594286-31594308 TGGGGAACCCATGGCCAGGGAGG - Intergenic
1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG + Intergenic
1146932845 17:36790386-36790408 GGAGAGACCCAAGGCCAGGTAGG + Intergenic
1147055765 17:37833671-37833693 TGGGAAGACTCATGCCAGGTAGG + Intergenic
1147369300 17:39980785-39980807 TGGGAAACGCCAGGCCCGGCAGG - Exonic
1147693458 17:42333289-42333311 TGAGAGGCCCCAGGGCAGGTGGG - Intronic
1148515555 17:48213662-48213684 TGGGAAACACCAAGGTAGGTTGG - Intronic
1149630206 17:58115969-58115991 TGAGAAAGCCCAGGCCTGGGAGG + Intergenic
1151940372 17:77288125-77288147 TCTGAAACCCCAGGCCGGGGTGG - Intronic
1152224237 17:79085392-79085414 TGGGAAACCCCAGAGCTGGAGGG + Intronic
1152434327 17:80265976-80265998 TGGGAAGCCCATGGCCAGGCTGG + Intronic
1152638697 17:81440641-81440663 TGGGTAACCCCAGGGCAGCCGGG + Intronic
1152946923 17:83203014-83203036 TGGGAAACACCAGGGCATGGAGG - Intergenic
1153685784 18:7543742-7543764 TGGGAAATCTCTGGCCAGGTTGG - Intergenic
1156241966 18:35263489-35263511 TGAGAAGCCCCAGTCCATGTGGG - Intronic
1158589610 18:58768538-58768560 AGGGAGACCCAAGGCCAGGCTGG - Intergenic
1160868153 19:1265283-1265305 TGTGTGACCCCAGGGCAGGTCGG + Intronic
1161460162 19:4391837-4391859 TGGGCCACCCCAGGACAGGCAGG - Intronic
1162106287 19:8371672-8371694 TGGGAAAACTGAGGCCAGATAGG - Intronic
1163827147 19:19530108-19530130 GGTGAAACCTCAGGCCAGGGTGG - Intronic
1164649596 19:29882411-29882433 TGGGTAGCCCCAGGCGAGGGTGG + Intergenic
1164673302 19:30085471-30085493 AAAGAAACCCCAGGCCAGGAAGG - Intergenic
1164706310 19:30322836-30322858 TGGGAAGCGCCAGGCCAGAGTGG - Intronic
1165056230 19:33177759-33177781 GTGGAAACTCCAGGCCAGGCAGG + Intronic
1165255727 19:34576475-34576497 AGGGAACCCTCTGGCCAGGTGGG + Intergenic
1165394378 19:35556377-35556399 TGGGAAAGCCAAGGCCAGGCAGG - Intronic
1167468957 19:49664892-49664914 GCGGAAACTCCAGGCCAGGTGGG - Intronic
1167966346 19:53150279-53150301 TGGGAAAACCCAGGACATCTGGG + Intronic
1168294084 19:55370314-55370336 TGGGGAACCCCTGGCCCTGTGGG - Exonic
1168638216 19:58012795-58012817 TGGCAGACCCCTGGCCAGGAAGG + Intergenic
924996317 2:365195-365217 TGAGAAAGCTCAGGCCAGGGAGG + Intergenic
925229184 2:2216754-2216776 TGGGAAATCCCTGGTCAGGCTGG + Intronic
929116942 2:38452519-38452541 AGGGAAACCCTGGGCCATGTGGG - Intergenic
929600821 2:43203685-43203707 TGAGAAACTGAAGGCCAGGTTGG - Intergenic
929966006 2:46537238-46537260 TGTGAAACCCCAGCCCCTGTGGG + Intronic
929972258 2:46592470-46592492 TGGGAAAGACCATGGCAGGTTGG - Exonic
930238079 2:48906842-48906864 TGGCAAAGCCCAGGCAAGGGAGG + Intergenic
930364543 2:50423359-50423381 TGGGAAAAGTCAGGCAAGGTAGG - Intronic
931522922 2:63119093-63119115 TGTGAAAGCCAAGGCCAAGTAGG - Intergenic
932331847 2:70902123-70902145 TGGGACACCCTGGGCCAGTTGGG + Intronic
932414780 2:71566900-71566922 AGGGAGAGCCCAGGGCAGGTAGG - Intronic
934572751 2:95382955-95382977 TGGGAAACCCAAGCCCAGGAGGG + Intronic
934857884 2:97740044-97740066 TGGGGAACCTGAGGCCAGGCGGG + Intergenic
937226370 2:120372206-120372228 GGGGACTCCCCAGGCCAGGAGGG + Intergenic
938094968 2:128455651-128455673 AAGGAAACCCCAGGGCAGGTGGG + Intergenic
938374338 2:130795946-130795968 TGGGAAATCCCAGGCAAACTGGG + Intergenic
939547339 2:143569589-143569611 TGGGCAAAGCCAGGCCAGGTAGG + Intronic
944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG + Intronic
945622246 2:212154760-212154782 AGGGAAACCCCAGGAGAGCTGGG + Intronic
947589854 2:231379434-231379456 TGGGATGCCCGAGGCCAGGGAGG - Intergenic
948358366 2:237398752-237398774 TGGGGAACCCCTGGCCAGTCTGG - Intronic
948386462 2:237583940-237583962 TGGGGAGTCCTAGGCCAGGTTGG - Intronic
948444430 2:238021032-238021054 TGTGACACCACAGGCCAGCTAGG - Intronic
1169332938 20:4730705-4730727 TGGGAATCCCCAGGACGGATGGG - Intergenic
1169581778 20:7031581-7031603 TGAGAAACATCATGCCAGGTTGG - Intergenic
1170605777 20:17874255-17874277 AGAGAAACCCCAGGCAAGGGAGG - Intergenic
1171110271 20:22474242-22474264 GGGGAAAAACCAGGCCAGGAAGG - Intergenic
1172006397 20:31821590-31821612 GAGAAAACCCCAGGCCAGGCTGG + Exonic
1172840457 20:37900155-37900177 TCAGAACCACCAGGCCAGGTAGG - Intergenic
1174169455 20:48606997-48607019 TGGGCTCCCCCAGCCCAGGTGGG - Intergenic
1174307344 20:49623132-49623154 TGGGACACCCCAGGCCTGACAGG + Intergenic
1175895759 20:62334943-62334965 TGGGGAACCCAAGGCCCGGAGGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177935747 21:27343286-27343308 TGAGGAACCTGAGGCCAGGTTGG + Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179091601 21:38271036-38271058 TGGGGAGCCCCAGGCCAGCAGGG + Intronic
1179423376 21:41253635-41253657 GGGGAAACCTCAGTCCAGGTGGG + Intronic
1180150495 21:45944714-45944736 TGGGGCACCCCAGCCCCGGTGGG + Intergenic
1181341300 22:22182147-22182169 TGGGGAGCCTCAGGCCAGGCTGG + Intergenic
1182088234 22:27576224-27576246 TGGGGACAGCCAGGCCAGGTTGG - Intergenic
1182300180 22:29332796-29332818 TGGGGAACCCCAGGTCCGCTTGG + Intronic
1182460909 22:30483444-30483466 TGGGTAACCCCAGGCATTGTGGG - Intergenic
1183197067 22:36360904-36360926 TGGGAAAGCCGAGGCCTGGGTGG - Intronic
1184381105 22:44145407-44145429 TGGGTTACCCCAAGACAGGTGGG + Intronic
1184817956 22:46886261-46886283 TGGGAAAACAGAGGCCAGGTGGG + Intronic
1184889207 22:47369223-47369245 GGGGAACCCACAGCCCAGGTTGG - Intergenic
1185173313 22:49305665-49305687 TGGACAACCCCAGGTGAGGTGGG + Intergenic
950147723 3:10663791-10663813 GGGGAAGCCCCATGCCAGGAAGG - Intronic
950311445 3:11961994-11962016 TGGGAAAACCAGGGGCAGGTTGG - Intergenic
950682206 3:14593108-14593130 TGGGAAAATCCAGGCCAGGCTGG - Intergenic
950703452 3:14766091-14766113 TGGGAAACAGCAGCCCAGCTCGG + Intronic
951495529 3:23321020-23321042 TGGCAAACACCAGACCAGTTAGG - Intronic
954413826 3:50383243-50383265 TGGGCAGCCTCAGGCCAGGGTGG - Intronic
954424028 3:50434015-50434037 GGGAAAACCCCAGGCCCGGAAGG + Intronic
955928443 3:64030919-64030941 TGGGGAATTCTAGGCCAGGTGGG + Intergenic
959278856 3:104311448-104311470 TGGGCAAAACCAGGCCAGATGGG + Intergenic
961497740 3:127306592-127306614 TGACAAAGCCCAGGCAAGGTCGG - Intergenic
962264775 3:133937005-133937027 TGAGAAAACCCAGGCCTGGAGGG - Intronic
965747657 3:171942351-171942373 TGGGAAACTCCAAGCCACCTTGG - Intergenic
967294358 3:187950585-187950607 GAGGAAACCCCAGGCCAGAAAGG + Intergenic
968423691 4:506473-506495 GGCTAAACCCCAGGCCAGGCAGG - Intronic
969244736 4:5924976-5924998 TGGGAATTCCCTGGCCAGGAAGG + Intronic
969662484 4:8538309-8538331 TGGGGAATCTGAGGCCAGGTTGG + Intergenic
969700729 4:8766231-8766253 AAGGAAACCCTGGGCCAGGTTGG - Intergenic
970710772 4:18859562-18859584 TGGGAATCCCCAGGGCAAGGAGG + Intergenic
972315077 4:37918737-37918759 AGGGAAATGCCAGGCCAGGCAGG - Intronic
973167556 4:47096276-47096298 TTGGAAACGCCAAGCCAAGTAGG + Intronic
977894033 4:102344659-102344681 AGGGGAAGCCCAGGCCAGGATGG - Exonic
978591911 4:110332955-110332977 TGGGAAATGCCAGGCCAAGATGG - Intergenic
981748042 4:148069468-148069490 TGGGGAAACCAAGGCCAGGCCGG - Intronic
981941118 4:150282470-150282492 TGGAAAACTCCAGGCCACGATGG - Exonic
985546848 5:514282-514304 TGGGAGACCTCAGGTCAGGGAGG - Intronic
985591120 5:766053-766075 TGAGAAACCCCAGGCCCCCTAGG - Intronic
986369721 5:7068199-7068221 TGGGAACCCTCAGGGCAGGGTGG - Intergenic
986584852 5:9305034-9305056 TGGGAGCCACCAGTCCAGGTTGG - Intronic
990410361 5:55535108-55535130 AGGGAAACCCCAGGCCGCGGCGG + Intergenic
993320323 5:86462242-86462264 TGGGATACCCCACGGCAGTTGGG + Intergenic
999776313 5:154815339-154815361 TTGGAACCCCAAGGCCAAGTTGG + Exonic
1001751051 5:174131727-174131749 TGGGAAGCCACAGGCCTGGGAGG + Intronic
1002092886 5:176815124-176815146 TGGGAAAATCCATGCCAGGGTGG - Intronic
1002344405 5:178537391-178537413 TGGGGAAACCGAGGCCGGGTGGG + Intronic
1003192885 6:3889773-3889795 TGGGATACCCCTGGCCAAGAGGG - Intergenic
1003590213 6:7431173-7431195 TGGGCGGACCCAGGCCAGGTGGG - Intergenic
1004274680 6:14225232-14225254 TGGGAAAACCTAGGCAAGGGTGG + Intergenic
1005850491 6:29817180-29817202 TGGGTCAGCCCAGGCCTGGTAGG + Intergenic
1005863097 6:29916440-29916462 TGGGTCAGCCCAGGCCTGGTAGG + Intergenic
1005874677 6:30001950-30001972 TGGGTCAGCCCAGGCCTGGTAGG + Intergenic
1006066316 6:31464819-31464841 TGGGTCAGCCCAGGCCGGGTAGG - Intergenic
1007260415 6:40559435-40559457 TGGGAATCCCCAGTTCAGCTGGG + Intronic
1008101453 6:47395819-47395841 TGGAAAATCCCAGGCCTCGTGGG + Intergenic
1011720787 6:90154674-90154696 TGGGGAACAACAGGCCAGGAAGG + Intronic
1014320256 6:119918998-119919020 TGGGAAAGCCCAAGCAAGCTGGG + Intergenic
1016615251 6:146040588-146040610 GTGGAAACCACAGGCCAGGAGGG - Intronic
1017765968 6:157607534-157607556 CAGAAAACCCCAGGCCAGGCAGG - Intronic
1019017235 6:168888641-168888663 AGGGAGATCCCAGGCCAGGCAGG + Intergenic
1019018286 6:168896487-168896509 TGGGAAACACCAGGCAATGCGGG - Intergenic
1020081920 7:5290904-5290926 TGGGAGGCCCCAGGCCATGATGG - Intronic
1020125396 7:5530334-5530356 GGGGACACCCCACGCCAGTTCGG - Intronic
1020323232 7:6955530-6955552 TGGGACACCCCACGGCAGTTGGG - Intergenic
1022034958 7:26525518-26525540 TGGGGAAGCCCAGGCAGGGTTGG - Intergenic
1022903309 7:34831948-34831970 GGGAAAGCCCCATGCCAGGTTGG + Intronic
1023881586 7:44324415-44324437 CGGGAGACCCCAGGCCAGACAGG + Intronic
1024055353 7:45657012-45657034 TGGGAAACCCCAGGCCAGCCTGG - Intronic
1024354529 7:48400953-48400975 GGGGAAGCCCCAGTCCATGTGGG + Intronic
1025111316 7:56218650-56218672 TGAGAAAACCCAGGCCATGTGGG + Intergenic
1026306591 7:69147811-69147833 TGAGAAAACCCAGGCCATGTGGG - Intergenic
1031992441 7:128207074-128207096 AGGTAAGACCCAGGCCAGGTTGG + Intergenic
1032260416 7:130331623-130331645 TCAGAGACCCCAGGCCCGGTGGG + Intergenic
1033225723 7:139560740-139560762 TGGGAAACCCCAGTCCCAGCAGG + Intergenic
1034470230 7:151250954-151250976 TGGGAAACCACAGGCCTTGGAGG + Intronic
1034535621 7:151724148-151724170 TGGGCAACCACAAGACAGGTAGG - Intronic
1034895727 7:154875320-154875342 TGGGAGCCGCCAGCCCAGGTCGG + Intronic
1035058353 7:156051554-156051576 GGGGAAACTCCAGACCAGGATGG - Intergenic
1035296346 7:157868845-157868867 TGGGGAACTCAAGGCCAGGAGGG + Intronic
1035422722 7:158742623-158742645 TGGGAGACCCCAGGCCCTGCGGG - Intronic
1036906160 8:12709991-12710013 TGGGACACCCCACGGCAGTTGGG - Intergenic
1037829352 8:22178803-22178825 TGGGAATGGCCAGGCCAGGAAGG - Intronic
1037931491 8:22882983-22883005 GGGGATACCCCAGGCTCGGTTGG - Intronic
1039839819 8:41285610-41285632 TGGGAAAAGTGAGGCCAGGTGGG - Intronic
1040523529 8:48198283-48198305 TGTTCAACCCCAGGCCAGGGAGG - Intergenic
1040674395 8:49731750-49731772 TGGGAAACACAAGTTCAGGTGGG + Intergenic
1042064021 8:64853963-64853985 TGGGAAGCACAAGGGCAGGTGGG + Intergenic
1045508357 8:102794532-102794554 TGGGGAGCCCCAGGGCAGGGTGG - Intergenic
1047306237 8:123655150-123655172 TGGGACACCACAGGGCAGGGTGG + Intergenic
1048956773 8:139543806-139543828 GTGGAACCCCCAAGCCAGGTTGG - Intergenic
1049646519 8:143738189-143738211 TCGCAAACCCCGGGCCAGGAGGG - Intergenic
1053784439 9:41644168-41644190 GAGGAAACCCCAGGCGGGGTCGG + Intergenic
1055113259 9:72580438-72580460 TGCAAAACCCAAAGCCAGGTTGG - Intronic
1056043800 9:82695578-82695600 TGGGTGAAGCCAGGCCAGGTGGG + Intergenic
1056833214 9:89933209-89933231 TGGGAAAGCCCAGGAAAGGATGG + Intergenic
1057722743 9:97545998-97546020 TCTGAAACCCCAGGACAGGGAGG - Intronic
1060521984 9:124299147-124299169 TGGGAGGCCCCAGGGCAGGTGGG + Intronic
1060549639 9:124478850-124478872 TGGGAGACCCCAGGCCTGAGTGG - Intergenic
1060940887 9:127542289-127542311 TGGAAAGCCCCAGGCTGGGTGGG + Intronic
1062224339 9:135440930-135440952 TGGGACACCCCATGGCAGTTGGG - Intergenic
1062503042 9:136859363-136859385 TGGCAAACCCCGAGCCAGGCTGG - Intronic
1062670537 9:137706149-137706171 CGCCAACCCCCAGGCCAGGTCGG - Intronic
1190204883 X:48394743-48394765 GGGGAGACCCAAGGCCAAGTGGG + Intergenic
1190205653 X:48400660-48400682 GGGGAGACCCAAGGCCAAGTGGG - Intergenic
1191154014 X:57252071-57252093 TGGGAACCACCAAGCCAGGCAGG - Intergenic
1192704136 X:73511386-73511408 TAGGACACTCCAAGCCAGGTTGG - Intergenic
1195511930 X:105725746-105725768 TGGGAAAACCAAGGACATGTGGG - Intronic
1197775231 X:130114450-130114472 TGGGTGAGCCCAAGCCAGGTGGG + Intergenic
1197920845 X:131592142-131592164 TGGGAAATCCCTGGCAAGCTAGG - Intergenic
1198678182 X:139153234-139153256 TGGGAAAGCGGAAGCCAGGTTGG - Intronic
1198715206 X:139551304-139551326 TGGCAAGACACAGGCCAGGTGGG + Intronic
1200063351 X:153493590-153493612 TGGGAAACCAGGGGCCAGGCTGG - Intronic
1200063402 X:153493781-153493803 TGGGAGGTCCCAGGCCAGGGAGG - Intronic