ID: 903125641

View in Genome Browser
Species Human (GRCh38)
Location 1:21245569-21245591
Sequence GCTCCTACTGCCCCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903125638_903125641 2 Left 903125638 1:21245544-21245566 CCAGGCCAAGCTTTCCATGATGA 0: 1
1: 0
2: 1
3: 14
4: 150
Right 903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG 0: 1
1: 0
2: 0
3: 28
4: 286
903125636_903125641 7 Left 903125636 1:21245539-21245561 CCCAGCCAGGCCAAGCTTTCCAT 0: 1
1: 1
2: 1
3: 28
4: 333
Right 903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG 0: 1
1: 0
2: 0
3: 28
4: 286
903125639_903125641 -3 Left 903125639 1:21245549-21245571 CCAAGCTTTCCATGATGACAGCT 0: 1
1: 0
2: 0
3: 18
4: 184
Right 903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG 0: 1
1: 0
2: 0
3: 28
4: 286
903125637_903125641 6 Left 903125637 1:21245540-21245562 CCAGCCAGGCCAAGCTTTCCATG 0: 1
1: 0
2: 2
3: 15
4: 215
Right 903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG 0: 1
1: 0
2: 0
3: 28
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903125641 Original CRISPR GCTCCTACTGCCCCACCTGC AGG Intronic
900080805 1:856128-856150 GCTCTTCCTTCCCCACCTGCTGG + Intergenic
900117841 1:1036045-1036067 GGTGCTCCTTCCCCACCTGCTGG - Intronic
900238364 1:1603195-1603217 TCTCCAACTGCCCCAGCTCCAGG + Intergenic
900367165 1:2315992-2316014 CCTGCTAGGGCCCCACCTGCCGG - Intergenic
900404017 1:2484600-2484622 ACACCTTCTGCTCCACCTGCAGG - Exonic
901084477 1:6602259-6602281 GCGCCTGCTGCGCTACCTGCGGG - Exonic
902226011 1:14996819-14996841 CCTCCCAGTGCCCCACATGCAGG - Intronic
902935488 1:19761877-19761899 GCTCCTCCTGCCACCTCTGCAGG + Intronic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
903213528 1:21831230-21831252 TCTCCCACTGCCCCACCTGTCGG - Exonic
903383720 1:22913609-22913631 GCCCCCTCTGCCCCACGTGCCGG + Exonic
903384400 1:22917043-22917065 TCTCCTACTGCCCCGCCACCCGG - Intergenic
904612951 1:31735330-31735352 GCTCATTCTGCCCCATCTCCCGG - Intronic
905275038 1:36812090-36812112 GCTTCTCCTGACCCATCTGCTGG - Intronic
905923996 1:41736995-41737017 ACTACTCCTGCCCCACCTCCAGG + Intronic
906154012 1:43603556-43603578 CCTCCTGCTGCCCCACCCTCAGG - Intronic
906816568 1:48886090-48886112 CCACCTACTTCCTCACCTGCTGG - Intronic
907985297 1:59524300-59524322 GTTCCTACTGAGGCACCTGCAGG - Intronic
908532377 1:65046278-65046300 ACTCCCAATACCCCACCTGCAGG + Intergenic
909562982 1:77025782-77025804 CCTCCTGCTGCCCCTCCTCCAGG + Intronic
910599140 1:89011872-89011894 GCACCTTCTGGCCCATCTGCTGG + Exonic
911498023 1:98654258-98654280 GCCACTACTGCCCCACCAGAGGG - Intergenic
915740747 1:158116592-158116614 GTTCCTCCTTCCCCAGCTGCAGG - Intergenic
915876213 1:159614199-159614221 CCTTCTACTACCCCACCTCCAGG - Intergenic
919821672 1:201476882-201476904 GCACCTACTGCCCCCTCTGATGG + Intergenic
920145972 1:203861434-203861456 GGTCCTACAGCGCCACCTGGAGG - Intergenic
920800926 1:209186666-209186688 TCTTCTACTCCCACACCTGCAGG + Intergenic
920857600 1:209675631-209675653 TCTCCTGCTGCTCCTCCTGCAGG + Exonic
922668850 1:227494140-227494162 GGTCCACCTGCTCCACCTGCAGG - Intergenic
922670748 1:227507162-227507184 GGTCCACCTGCTCCACCTGCAGG + Intergenic
923000396 1:230002279-230002301 GCTCCTCCTGCTGCACCTGCAGG - Intergenic
924074194 1:240316349-240316371 GATCATACTGCTCCATCTGCTGG - Intronic
924606340 1:245538651-245538673 GTTCCCACTCCCCTACCTGCTGG - Intronic
924813555 1:247423980-247424002 GCTCCTGCTCCCTCTCCTGCTGG - Exonic
1063538612 10:6909940-6909962 GTTCCCACTGCACCACTTGCAGG - Intergenic
1068648202 10:59492888-59492910 GCCCCACCTGCCCCAGCTGCAGG + Intergenic
1070146832 10:73780498-73780520 GATCCTCCTGCCTCAGCTGCTGG - Intergenic
1070858674 10:79630219-79630241 GCTCCTACTCCCCCTCCTGGAGG - Intergenic
1072121035 10:92405743-92405765 GCTCCTCCTGCACCAAGTGCAGG + Intergenic
1074119744 10:110485109-110485131 GCTCCTTCAGCCCCATCTCCAGG - Intergenic
1075554925 10:123423439-123423461 GCTCCTACTGCCCCTTATGCAGG - Intergenic
1075792560 10:125095431-125095453 GCTCCTCCTGCCCTCCTTGCTGG - Intronic
1076150478 10:128158270-128158292 GCGCCTCCTGCGGCACCTGCAGG - Intergenic
1076801867 10:132834742-132834764 GCTCCTTCTCTTCCACCTGCAGG + Exonic
1076922554 10:133462136-133462158 GCTCCTGCTGTCCCACGTGTGGG + Intergenic
1077040407 11:518697-518719 GCGTTTCCTGCCCCACCTGCTGG - Intergenic
1078561639 11:12377799-12377821 GCTCCTACCGCCCGCCCGGCCGG - Intronic
1079298035 11:19252120-19252142 CCTCCCACTGCCCCTACTGCAGG + Intergenic
1080259606 11:30333584-30333606 GTTCTTACTGCTCCACCTACTGG + Intronic
1080842338 11:35996319-35996341 GCTCTTACTACCCCACCATCAGG - Intronic
1081775254 11:45671847-45671869 GCTCCAAGTGCACCATCTGCAGG + Intergenic
1081992730 11:47346482-47346504 GCTCCAGCTGCCCCACCAGAAGG - Intronic
1083439506 11:62666514-62666536 GCTCCTACTGCCATTGCTGCAGG + Exonic
1083560787 11:63671457-63671479 GCTCCGCGTGCCCCACCTTCTGG - Exonic
1084243187 11:67836753-67836775 GTTCCTACTGCCCCACCCCTGGG - Intergenic
1084363660 11:68684579-68684601 GCGCCTTCTGCCCCTGCTGCCGG + Exonic
1084483226 11:69433979-69434001 TTTCCTGCTGCCCCACTTGCTGG - Intergenic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084691728 11:70731408-70731430 GCTCCTTCTCCCCCATCTCCTGG + Intronic
1084718633 11:70889908-70889930 GCTCCTACTCCCCCATGTCCTGG - Intronic
1084829796 11:71760187-71760209 GTTCCTACTGCCCCACCCCTGGG + Intergenic
1085143543 11:74171480-74171502 GCTCTGACTGCCCCCGCTGCCGG - Exonic
1085732523 11:79011702-79011724 TTCCCCACTGCCCCACCTGCTGG + Intronic
1085945448 11:81265738-81265760 GCTCTTGTTGTCCCACCTGCTGG + Intergenic
1090580901 11:128157820-128157842 GCTGTTACAGCTCCACCTGCTGG - Intergenic
1092274241 12:7047114-7047136 GCTCCCACTTCCCCAAGTGCTGG - Intronic
1092413437 12:8271491-8271513 GTTCCTACTGCCCCACCCCTGGG - Intergenic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1092951627 12:13508963-13508985 GCTCAGAGTGTCCCACCTGCTGG + Intergenic
1094091233 12:26652547-26652569 GCTCTTATTGCCCCAGCTGCTGG + Intronic
1099341064 12:81435274-81435296 GCTCCCACTGACCTCCCTGCTGG + Intronic
1101422605 12:104562009-104562031 GCTCCTACTGCCCAGTCTCCTGG + Intronic
1101761195 12:107660315-107660337 GCTCACATTGCCCCACCTCCCGG + Intergenic
1102389696 12:112539647-112539669 GCACTTGCTGCCCCAACTGCTGG + Intergenic
1103343614 12:120234877-120234899 GCTCCGACTCCTCCCCCTGCTGG - Intronic
1103494626 12:121352133-121352155 GCTGCTCCTGCCCCTGCTGCAGG - Exonic
1103856052 12:123972352-123972374 GGTCCTCCTGCCCCACCTCCGGG - Intronic
1103907822 12:124336271-124336293 GGGCCTACGCCCCCACCTGCCGG - Intronic
1103941210 12:124502233-124502255 GCTCCTGCTGCCCGGCCTGGTGG + Intronic
1104641767 12:130471717-130471739 GCTCCTGCTGCTCCTGCTGCAGG + Intronic
1105409950 13:20162956-20162978 TTTCCCACTGCCCCAGCTGCTGG - Intergenic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106220426 13:27742258-27742280 GCTCCAGCTGCATCACCTGCAGG + Intergenic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1107134850 13:36932800-36932822 GCTACTACTGCCACAACTACTGG - Intergenic
1108572368 13:51764328-51764350 GCCCCTCCTGCCACACCTGCTGG - Exonic
1112004343 13:95241518-95241540 CTTCCTCCTGCCCCCCCTGCAGG + Intronic
1112329558 13:98466790-98466812 ACTCCTACTACGCCTCCTGCTGG + Intronic
1113489939 13:110683383-110683405 ACTCCTATAGCCCCACCTACTGG - Intronic
1114628386 14:24144151-24144173 GCTCCTACTGCCCCCAATGCTGG + Intronic
1114808466 14:25865378-25865400 GCTTCTACTGACCCACTTCCAGG + Intergenic
1118619289 14:67600123-67600145 GCTACTACTCCCCGTCCTGCCGG - Exonic
1119380264 14:74224013-74224035 GCTCCTTCTGCCCCCCTGGCTGG - Intergenic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1120685150 14:87529285-87529307 CCCCCTACTGCCAGACCTGCAGG + Intergenic
1121574775 14:94975150-94975172 GCTCACCCTGCCCCACCCGCTGG + Intergenic
1121655882 14:95595224-95595246 GCTCCTCCTCGCCCACCTCCTGG + Intergenic
1122074725 14:99228757-99228779 GCTCCTCCTTCCCCTTCTGCAGG + Intronic
1122804466 14:104249667-104249689 GCTCCTTCTGTCCCACCAGGGGG - Intergenic
1122970043 14:105148767-105148789 GCTGCTTCTGCCCCAGCGGCTGG - Exonic
1122971399 14:105153682-105153704 GCTCCGCCTGCCCCTCTTGCTGG - Intronic
1123062318 14:105599846-105599868 CCTCCCACTGCCCCTCCTGGGGG + Intergenic
1123087060 14:105721574-105721596 CCTCCCACTGCCCCTCCTGGGGG + Intergenic
1125328907 15:38564188-38564210 GCTCCGGCTGCGCCACCTGGTGG - Intronic
1125356443 15:38821406-38821428 TCTCCTACTGCCCCCCATCCAGG - Intergenic
1125509669 15:40286247-40286269 TCCCCTCCTGTCCCACCTGCTGG + Intronic
1125720249 15:41841900-41841922 GCTTCCACTGCCCAGCCTGCTGG + Exonic
1125727488 15:41875478-41875500 GCTCCTGCTGTCCAGCCTGCTGG + Exonic
1125759824 15:42088814-42088836 GCTCCCACTGCCCCACTCCCCGG - Intronic
1126755871 15:51924333-51924355 CCTCCCTCTGCCCCACCTCCTGG + Intronic
1127514305 15:59676815-59676837 GCTACTACTTCCCTTCCTGCCGG + Intronic
1128719750 15:69939753-69939775 GCTGCTGCTGCCCCAACTCCTGG - Intergenic
1128781796 15:70363153-70363175 GCACCTCCTGGCCCACCAGCTGG + Intergenic
1128807354 15:70540783-70540805 GCTCATCCTGCCCCACCCTCAGG + Intergenic
1129465241 15:75721162-75721184 ACTCATGCTGCCCCTCCTGCTGG - Intergenic
1131319121 15:91369170-91369192 TCTCCTATTGTCACACCTGCGGG + Intergenic
1133051228 16:3118601-3118623 GCTCCTACACCCACACCTGGAGG - Intronic
1133125150 16:3641705-3641727 TCTCCCACTGCCCCACCCTCAGG - Intronic
1133929763 16:10222748-10222770 GCCCCTACTTCCCCTCCTCCTGG + Intergenic
1134589128 16:15437829-15437851 GCGCCTATTGTCCCAGCTGCCGG + Intronic
1136247277 16:28983236-28983258 GATCGTGCTGTCCCACCTGCTGG + Exonic
1136398823 16:30006933-30006955 GCTCCGCCTGCTCCAACTGCGGG + Exonic
1137407704 16:48203086-48203108 GCTCCTCCTGCAGCAGCTGCAGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1141435135 16:83995787-83995809 GCTCAAACTTCCCCTCCTGCAGG + Intronic
1141999967 16:87658683-87658705 AGTCCTCCTGCTCCACCTGCTGG - Intronic
1142403148 16:89871564-89871586 GCTCCTCTGGCCACACCTGCTGG + Intergenic
1142595331 17:1027058-1027080 GCTCCCCCAGCCACACCTGCAGG + Intronic
1142671047 17:1487519-1487541 GCTCCCACTCCCCCACCAGCTGG - Intronic
1143478230 17:7215010-7215032 GCTCCTGCTTCCCCAAATGCTGG - Intronic
1143604253 17:7972301-7972323 GAGCCTACTGCCCCACCCTCTGG - Intergenic
1146539235 17:33680287-33680309 GCTCCAGCTGCCTGACCTGCAGG + Intronic
1146680983 17:34808096-34808118 GCTCCTACTGTTCCTCCTACTGG + Intergenic
1146794307 17:35770312-35770334 TGACCTTCTGCCCCACCTGCAGG - Exonic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1147161507 17:38571925-38571947 GTTCCTACTTCCCCTGCTGCTGG + Intronic
1147363144 17:39943987-39944009 TCACCTCCTGCCCCTCCTGCTGG + Exonic
1147416620 17:40295905-40295927 CATCCTCCTGCCCCTCCTGCTGG + Intronic
1148218088 17:45844876-45844898 GTTCCTACTGCAACATCTGCGGG - Exonic
1148437495 17:47694941-47694963 GCTCCTGCAGCCCGACCTGGGGG + Intronic
1148738012 17:49875711-49875733 GCTCCTTCTGGCCCTCTTGCTGG - Intergenic
1148779618 17:50114016-50114038 GCAGCCACTGGCCCACCTGCTGG + Exonic
1148891543 17:50811188-50811210 GCTCTTCCTACCCCATCTGCAGG + Intergenic
1149999270 17:61422858-61422880 GTTCCAACTGCTCCACATGCAGG - Intergenic
1152049413 17:77960056-77960078 GCTCCTCCTCCCCTACCTCCCGG - Intergenic
1152289238 17:79429456-79429478 CCTCCTCCTGCCCAGCCTGCTGG - Intronic
1152350633 17:79782201-79782223 GCTACTCCGGGCCCACCTGCGGG + Intronic
1152898164 17:82925508-82925530 GGTCCCACTGACCAACCTGCCGG + Intronic
1152947399 17:83205506-83205528 GCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1153480527 18:5543201-5543223 CCTCCTCCTCCCCCACCGGCCGG + Intronic
1155221652 18:23690344-23690366 GCGCCTCCTGCCCCACCTCCCGG + Intronic
1157070115 18:44396782-44396804 GCTCTCACTGCCCCATCAGCAGG + Intergenic
1157502942 18:48203657-48203679 GCCCCCACTGCCCCACCCCCTGG + Intronic
1158962508 18:62598066-62598088 CTTCCTGCGGCCCCACCTGCAGG + Intergenic
1160097170 18:75884918-75884940 GTTCTCACTGCTCCACCTGCTGG - Intergenic
1160299755 18:77668984-77669006 GCTGCTCCAGCCCCAGCTGCCGG + Intergenic
1160428403 18:78794079-78794101 GCCCACCCTGCCCCACCTGCTGG - Intergenic
1160493166 18:79354765-79354787 GCTCCTTCAGCTCCAGCTGCTGG - Intronic
1161589529 19:5123023-5123045 AGTCCTAGTGCCCCACCAGCAGG - Intronic
1163127113 19:15250290-15250312 CTTCCTACTCCCCCACCTCCAGG + Intronic
1163347156 19:16750370-16750392 GCTCCTCGTGGCCCACGTGCTGG + Exonic
1163833897 19:19562062-19562084 CCTGCAACTGCCTCACCTGCTGG - Exonic
1166671900 19:44715264-44715286 CCTCCTTCTGCCCCTCCTGCTGG - Intergenic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167508639 19:49884158-49884180 GCCCCCACTGCTCCTCCTGCTGG - Intronic
1167740055 19:51319108-51319130 GCTCCTGCTGACACACCTTCTGG - Intronic
1168120171 19:54247575-54247597 CCTCCTGCTGCCCCACCAGGTGG + Intronic
1168631119 19:57956923-57956945 CCTCCTGCTGCCCCAGCTCCTGG + Intergenic
925125943 2:1455921-1455943 GCTCCTCCTGCCCTAACTCCAGG + Intronic
925185203 2:1842397-1842419 GCCCCTGCTGCCCCACCTCCTGG + Intronic
925412900 2:3650283-3650305 GCTCCCACTGCTCCTCCTGGGGG + Intergenic
925633175 2:5915885-5915907 GCTCATACTGCTGCCCCTGCTGG + Intergenic
927683128 2:25153416-25153438 GCCCCTACTGCCCCATCTTAAGG + Intronic
927963534 2:27255359-27255381 GCTGATACTGCTCGACCTGCAGG + Exonic
929260928 2:39865918-39865940 GTTCCTCCCTCCCCACCTGCAGG + Intergenic
929593203 2:43160087-43160109 CCTCCTACTCACCCACCTCCTGG + Intergenic
929781341 2:44959160-44959182 GCTCCTTCTGGCCCATCTGCAGG - Intergenic
932568785 2:72925663-72925685 GCTCCGGCTGCCCCCCATGCCGG - Intronic
933527962 2:83467900-83467922 GCTCCTTCTTCCTCACATGCCGG + Intergenic
933833301 2:86227373-86227395 GTACCTGCTGCTCCACCTGCAGG - Intronic
934096944 2:88615411-88615433 CCTCCTAAAGCCCCACCTCCTGG - Intronic
935312007 2:101793513-101793535 GCTCCAATAGCCCCTCCTGCTGG - Intronic
935618305 2:105108088-105108110 GATGCTACTGCCCTGCCTGCAGG - Intergenic
937067642 2:119029957-119029979 GCTCCTATTCTCCCAGCTGCTGG - Intergenic
938405713 2:131032093-131032115 GCTGCTTCTGCCCCACCTCATGG + Intronic
938500846 2:131830755-131830777 ACACCAACTACCCCACCTGCTGG + Intergenic
938501440 2:131833011-131833033 GCTCTTCCTGCCCGCCCTGCAGG + Intergenic
943433217 2:187830118-187830140 CCTCCTACTGACCCACCTTTTGG - Intergenic
946488635 2:220126067-220126089 GATCTGACTGCCCCAGCTGCTGG - Intergenic
947156225 2:227164759-227164781 GCTCCTGCTGCCGCTCCTGCTGG + Exonic
948176878 2:235950437-235950459 GCTCCTCCTGCAACTCCTGCAGG - Intronic
948777593 2:240297705-240297727 GCTCCTCCTGCTCCACATGGGGG + Intergenic
1170924727 20:20712502-20712524 GCGCCTACTGCCCCGCCGGCGGG - Intergenic
1171182071 20:23098224-23098246 TCTCCTACTGCCCCATCTCGCGG + Intergenic
1172756675 20:37289975-37289997 TCTCCTACTGCTCCACCCGTGGG - Intronic
1174357873 20:50010232-50010254 CCTCCTGCTCCTCCACCTGCCGG - Intergenic
1174481397 20:50833809-50833831 GCTCCTCCAGGACCACCTGCAGG - Intronic
1176164276 20:63664614-63664636 GCTCTCACTGCCCGACCTGGCGG + Intronic
1180037966 21:45259754-45259776 GCTCCTCCTGCCCCTCGTTCGGG + Intergenic
1180624985 22:17188432-17188454 TGTCCTCATGCCCCACCTGCAGG + Exonic
1181087709 22:20449982-20450004 GCTCCTCCTGAGCCACCTGCTGG + Intronic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181271471 22:21661230-21661252 GCTCCCACTGACCGACTTGCAGG + Intronic
1182053334 22:27330153-27330175 GCTGGCACTGCCCCAGCTGCTGG + Intergenic
1182555698 22:31127293-31127315 GCTCCCAGTGCCTCACCTCCTGG + Intronic
1183524423 22:38315162-38315184 GCTCCGGCTGTCCCACCTGGTGG + Intronic
1183671866 22:39277906-39277928 CCTCCTACCCCCCCAACTGCAGG + Intergenic
1183830728 22:40417258-40417280 GCTCCTACAGCCCCACCCGGAGG - Intronic
1184834858 22:47015069-47015091 GTTCCTGATGCCCCACCTGCGGG + Intronic
1184839551 22:47044418-47044440 GCTCCAAGTACCGCACCTGCTGG + Intronic
1185108220 22:48886031-48886053 TCTCCTACTTCCCCATCTCCAGG - Intergenic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
949942013 3:9162539-9162561 GCTCCTTCTGGTCCACTTGCAGG + Intronic
951599789 3:24360990-24361012 GCTCCTACAGCTCCAGCTGATGG + Intronic
952350260 3:32528481-32528503 CCACCTCCAGCCCCACCTGCAGG + Exonic
953369610 3:42376277-42376299 GCCTCTACTTCCCCACCTTCAGG - Intergenic
953837760 3:46362019-46362041 GCTCCAACCTCCCCAGCTGCTGG - Intergenic
954146622 3:48637608-48637630 GCTCATACCGCCCCTCCTGGTGG - Exonic
954149200 3:48648781-48648803 CCGCCTGCTGGCCCACCTGCTGG - Exonic
961890992 3:130130141-130130163 GTTCCTACTGCCCCACCCCTGGG - Intergenic
962222125 3:133573278-133573300 GAACCCACTGCCCCTCCTGCTGG + Intergenic
968092929 3:195909468-195909490 GCTCCTCCTGCGCGACCCGCCGG + Intronic
968593213 4:1470025-1470047 GCACCTACTGCCAGAGCTGCTGG + Intergenic
968650947 4:1760060-1760082 GCTCTGCCTGCCCCACCTCCTGG - Intergenic
969002379 4:3992565-3992587 GTTCCTACTGCCCCACCCCTGGG - Intergenic
969377273 4:6771275-6771297 GCCCCTACGGCCACTCCTGCTGG + Intergenic
969478570 4:7434843-7434865 GCTCCTCCTGCCCAGCCTCCTGG - Exonic
969751628 4:9115953-9115975 GTTCCTACTGCCCCACCCCTGGG + Intergenic
969811545 4:9652247-9652269 GTTCCTACTGCCCCACCCCTGGG + Intergenic
970456437 4:16227388-16227410 GCTCCCACCGCCCCAGCTGGTGG - Intronic
973242140 4:47968590-47968612 ACTCCTACTGCCCCAAGAGCAGG + Intronic
975476654 4:74831329-74831351 GCTCCTTCTGCCCAAACTCCTGG + Intergenic
975715868 4:77205460-77205482 GCTCCTAATGCCACACTTTCAGG - Intronic
976552984 4:86417758-86417780 GTTCCTGCTGCCCCACCTAGAGG + Intronic
980704486 4:136475157-136475179 CCACCAAGTGCCCCACCTGCAGG + Intergenic
982288062 4:153755086-153755108 GCTCTTACAGCCCTGCCTGCAGG - Intronic
984865254 4:184275352-184275374 GCTCCACCTGCCCCAGCTGTTGG - Intergenic
985666528 5:1184069-1184091 GCTCCTCCTGCCCCACCCCAGGG - Intergenic
986296528 5:6443891-6443913 CCTCCTAGCGCCCCAGCTGCAGG + Intergenic
987607508 5:20156570-20156592 TCTCCCCCTGCCCCACCTTCTGG - Intronic
988846383 5:35132004-35132026 ACTCCTCCTTCCCCTCCTGCTGG - Intronic
991001238 5:61785063-61785085 CCTCCTACCGCCCCACCTCTTGG + Intergenic
994250505 5:97531428-97531450 TCTCCTACTGCCCCATCTCTTGG - Intergenic
997470036 5:134112522-134112544 GCTCCAACTCCCCACCCTGCTGG - Intergenic
998337956 5:141390028-141390050 GCTCCTCCAGCCCCGCCTCCTGG + Exonic
999301413 5:150492969-150492991 GCTCTTCCTGATCCACCTGCAGG + Intronic
999884515 5:155906220-155906242 GTTCTGACTGCTCCACCTGCAGG + Intronic
1000863244 5:166481957-166481979 GCCCCTAATACCCCACATGCTGG - Intergenic
1001454271 5:171848675-171848697 GCTGCTCCTCCCCCACATGCAGG - Intergenic
1001563805 5:172686864-172686886 GGGCCTGCTGCCCCATCTGCCGG + Exonic
1002399669 5:178984603-178984625 GCTCCTGCTCCCCCACCCTCAGG - Intronic
1002399935 5:178986114-178986136 GAGCCTACGGACCCACCTGCAGG + Exonic
1002463215 5:179387232-179387254 GATCCCACTCTCCCACCTGCAGG - Intergenic
1003171226 6:3723449-3723471 GCCCCTGCTGCTCCACTTGCAGG + Exonic
1004615022 6:17281328-17281350 TCTCCTCCCGCCCCCCCTGCCGG - Exonic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006717589 6:36130428-36130450 GCTGCTACGCTCCCACCTGCCGG - Exonic
1007108977 6:39302083-39302105 GCCCCAACTGCTTCACCTGCAGG - Intronic
1007375354 6:41452527-41452549 GGTCCCACTGCACCACCTGTGGG + Intergenic
1007414794 6:41684982-41685004 GCTCCTGCTTCACCACCTGCTGG + Exonic
1015640442 6:135326331-135326353 TCTCCTACTGCCTCTCCTGCTGG - Intronic
1016171510 6:141024011-141024033 GGGCCTACTGCCCCAGCTGCTGG + Intergenic
1018792130 6:167156962-167156984 GCTTCTCCAGCCCCACCTTCAGG - Exonic
1019068610 6:169323408-169323430 CCCACTACTGCCCCACCTGGAGG - Intergenic
1019267114 7:124156-124178 GATCCTTCTCCCCCACCTCCTGG + Intergenic
1019328136 7:449417-449439 GCAGCTACTTCCGCACCTGCAGG + Intergenic
1020149792 7:5673138-5673160 ACACCAAATGCCCCACCTGCGGG + Intronic
1023969636 7:44981350-44981372 GCTCCTACGGCTGCACCTGCAGG + Intergenic
1024318243 7:48041222-48041244 GCTTGCACTGCCCCACCTGATGG + Intronic
1024627417 7:51219909-51219931 GCTCGTGCTCCCCCACCTCCTGG - Exonic
1026688589 7:72533492-72533514 TCTCCTCCTGCTCCAGCTGCTGG + Intergenic
1026723821 7:72855389-72855411 TCTCCTCCTGCTCCAGCTGCTGG + Intergenic
1027201490 7:76066793-76066815 GCTCCTCCCGCCCCTCCTGTTGG + Exonic
1028082743 7:86598950-86598972 TCCCCTACTCCCCCACCTCCAGG - Intergenic
1028585589 7:92447983-92448005 GCTCCTCCGGCCCCTCCCGCCGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1031966152 7:128029974-128029996 GCTCCTCCAGCCCCACCAGGGGG + Exonic
1032013033 7:128359379-128359401 GCCCCTGCTGCCCAGCCTGCGGG - Exonic
1035078815 7:156199379-156199401 TCTCCCTCTGCCTCACCTGCAGG + Intergenic
1035176401 7:157055133-157055155 CCTCCCACAGCCCCACCTGCAGG + Intergenic
1035469836 7:159102708-159102730 GCTCCGCCTGCCCCTCCTGGAGG - Intronic
1035524462 8:301334-301356 GCTCTTCCTTCCCCAGCTGCTGG - Intergenic
1039604686 8:38870846-38870868 GCTCCCACTCCCCACCCTGCAGG + Intergenic
1040731252 8:50449827-50449849 GCTCCAGCTTCCCCACCTTCAGG + Intronic
1040947149 8:52895347-52895369 GCACCTACAGCCCCACCTCCTGG - Intergenic
1042023621 8:64399441-64399463 TGTCTTGCTGCCCCACCTGCTGG - Intergenic
1044420999 8:91995679-91995701 GATCCTCCTGCCCCAGCTTCTGG - Intronic
1045073176 8:98532341-98532363 GTTCTGACTGCCCCACCAGCAGG - Intronic
1047522938 8:125609415-125609437 GCTCCTCCTGTGCCAGCTGCTGG + Intergenic
1048133386 8:131721654-131721676 GCTTCCACTTCCCCATCTGCTGG + Intergenic
1049501959 8:142971693-142971715 GTTCCTGCTGCCCCACCCTCGGG - Intergenic
1049745316 8:144260787-144260809 GCCCCTGCTGCTGCACCTGCAGG + Exonic
1050123873 9:2336266-2336288 GCTGTTACTGCACCCCCTGCTGG - Intergenic
1050559468 9:6820175-6820197 GCTCATACTGCCTCTCCCGCAGG - Intronic
1054912869 9:70469919-70469941 GATCCTCCTGCCCCAGCTGCTGG + Intergenic
1056661135 9:88544231-88544253 GCTCCTGCTCTCCCTCCTGCTGG - Intronic
1060586624 9:124790630-124790652 CCTCCTCCAGCCCCACCTGCCGG - Intronic
1060662124 9:125410763-125410785 GCCCCTCCTGCCCCTTCTGCCGG - Intergenic
1061681288 9:132243611-132243633 GCTGCCACTGCTCCACCTGCAGG + Exonic
1061802635 9:133120784-133120806 GCCCCCACTGCCCACCCTGCTGG + Intronic
1061886004 9:133591436-133591458 GCTCATCCTGCCCCTCCTCCTGG + Intergenic
1061926440 9:133808267-133808289 CCTCCTGCTGCCCCACCCTCTGG - Intronic
1062082081 9:134629554-134629576 GACCCAACTGCCCCAGCTGCAGG - Intergenic
1062100445 9:134725223-134725245 GCTGATCCTGCCCCAGCTGCTGG + Intronic
1062337659 9:136079486-136079508 GGGCTTGCTGCCCCACCTGCTGG - Intronic
1062430088 9:136523064-136523086 GCTTCCATGGCCCCACCTGCCGG - Exonic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1186140617 X:6567999-6568021 GGTCCTGATGCCTCACCTGCTGG + Intergenic
1186556693 X:10567368-10567390 CCTTCCAGTGCCCCACCTGCCGG - Exonic
1187507252 X:19887727-19887749 GCTCCTGCAGCTCCGCCTGCCGG + Intergenic
1189496637 X:41514708-41514730 GCTCCTGGTGCCCATCCTGCAGG - Intergenic
1189947258 X:46191807-46191829 GGTCTTATTGCCCCAGCTGCTGG - Intergenic
1198532235 X:137558405-137558427 GATCCTCCTGCCACCCCTGCAGG - Intergenic
1200316446 X:155137328-155137350 GCTCAAACTCCCCCTCCTGCAGG - Intronic
1201622056 Y:15970215-15970237 GATCCTGATGCCTCACCTGCTGG + Intergenic