ID: 903126380

View in Genome Browser
Species Human (GRCh38)
Location 1:21251024-21251046
Sequence CTGAATTTGCAGATGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903126375_903126380 26 Left 903126375 1:21250975-21250997 CCAGCCTGGGCGACAGAGCGAGA 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
Right 903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG 0: 1
1: 0
2: 1
3: 23
4: 300
903126376_903126380 22 Left 903126376 1:21250979-21251001 CCTGGGCGACAGAGCGAGACTCA 0: 390
1: 28106
2: 85226
3: 159823
4: 165358
Right 903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG 0: 1
1: 0
2: 1
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903126380 Original CRISPR CTGAATTTGCAGATGGGGTA AGG Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
901861470 1:12077419-12077441 CCGGCTTTGCAGATGGAGTAAGG + Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
903103126 1:21050943-21050965 CTGAATAAGGGGATGGGGTAGGG + Exonic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903613436 1:24633862-24633884 ATGAATTTGGAGATGGTGAAGGG + Intronic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
905477822 1:38241416-38241438 CTGAATTTGGACTTGGGGTAGGG - Intergenic
905554993 1:38875276-38875298 GTGAATTTGCAGATGTGCTCTGG + Exonic
906071361 1:43019054-43019076 GTGACTTTCCAGATGGGCTAAGG + Intergenic
907633711 1:56110898-56110920 TTGAATTTGCAGATTGGTTTTGG + Intergenic
908363830 1:63396999-63397021 CTGAATTTGCAGATCTGAAAAGG + Intronic
908574128 1:65441285-65441307 CTGATTTAGCAGAAGGGGTGGGG + Intronic
909503540 1:76362321-76362343 CTCATATTGCAGATGGGGTCTGG - Intronic
909604057 1:77490960-77490982 CTGACTTTTCAGGTGAGGTATGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913557032 1:119977782-119977804 GTGAATTTGGAGATGAGGTTGGG + Intronic
914904744 1:151734658-151734680 CTGAGTTTGCAGTTGGGTCATGG + Intergenic
917710590 1:177680288-177680310 CTGAATTTGTAGAGGGAGTCTGG - Intergenic
918789590 1:188809205-188809227 CTGAAAGTGGTGATGGGGTAAGG - Intergenic
918924069 1:190757014-190757036 CTCAACTTGCAGATGGCCTATGG + Intergenic
919751757 1:201042067-201042089 CTGAGAGTGCAGAGGGGGTATGG - Intronic
920645361 1:207799329-207799351 CTGAATAGGAAGATAGGGTAGGG + Intergenic
920959110 1:210648571-210648593 CTGAATAAGCAGATTGGATACGG - Intronic
923979457 1:239304790-239304812 ATGTATTTGCAGATGGCTTAAGG + Intergenic
1063141508 10:3260132-3260154 TTGAATTTGGAGATGTGGTCTGG + Intergenic
1063929403 10:11014147-11014169 TTGAATTTGCAAATGTGATAGGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1064510582 10:16086109-16086131 CTGTTTTTGCATATGGTGTAAGG - Intergenic
1064747937 10:18496288-18496310 CACAATTTGCAGATTGGGAAAGG - Intronic
1065968505 10:30787432-30787454 CTGAGTTTGCAGTTGTTGTAGGG - Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1073179703 10:101576226-101576248 CTGGCTTTGAAGATGGGGAAAGG - Intronic
1074145530 10:110714083-110714105 CTGATTCTGAAGATGGGCTATGG + Intronic
1074863228 10:117529048-117529070 CTGCATTTCCTGATGGGGTGAGG - Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1078831360 11:14980245-14980267 GTGAATTTCCAGTAGGGGTAGGG + Intronic
1079632224 11:22692144-22692166 CTACATTTGCAGATGGGGGTGGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079760329 11:24321070-24321092 CTGATTTTGCAGCTGTGGTAAGG - Intergenic
1080298973 11:30762876-30762898 CAGAATTTGGTGATGGGGTGGGG - Intergenic
1081397629 11:42605646-42605668 GTGAATCTGGATATGGGGTATGG - Intergenic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083163006 11:60867285-60867307 CTGAGGTTGCAGATGGGCTGTGG - Intergenic
1083402105 11:62430685-62430707 CTGACTTTGAAGATGGGGAAGGG - Intergenic
1084125585 11:67096865-67096887 TTGAACTTGCAGATGTGGGAAGG - Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084805183 11:71573815-71573837 CTGAATTTGCAATTTGGCTAAGG - Intergenic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1085922106 11:80969733-80969755 CTGATTCTGCAGAGGAGGTAAGG + Intergenic
1088556391 11:111065584-111065606 CCCTATTTGGAGATGGGGTAGGG + Intergenic
1089078974 11:115760542-115760564 CTGAATTTCTAGAAAGGGTAGGG - Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090275426 11:125415550-125415572 GTGAATTTGCAAGAGGGGTAAGG + Intronic
1090563334 11:127958105-127958127 CTGACTTTGAAGATTGGGAAGGG - Intergenic
1090572470 11:128062158-128062180 GAGCATTTGAAGATGGGGTAGGG + Intergenic
1091672021 12:2458631-2458653 ATGAGTTTGGAGATGGTGTAAGG + Intronic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1094336321 12:29359200-29359222 CTGAATCTGAAGATGGGATCTGG - Intronic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098857122 12:75665558-75665580 CTGTAATTTCACATGGGGTAAGG + Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104495971 12:129239375-129239397 TTAAATTTGTAGATGGTGTAAGG + Intronic
1105776309 13:23664452-23664474 TTTAATTTGCAGAGGAGGTAAGG - Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1107453797 13:40536165-40536187 CTGAATATGCAGAGGGCTTAAGG + Intergenic
1107638453 13:42416778-42416800 CTGACTTTGCAGATGTGATTAGG + Intergenic
1107702916 13:43066516-43066538 CTGACTTTGCAGATGTGATTAGG - Intronic
1108071946 13:46637162-46637184 CTGAATTTGCTGATTGGATGGGG - Intronic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1111311128 13:86487626-86487648 CTGGCTTTAAAGATGGGGTATGG - Intergenic
1112786038 13:102952796-102952818 GTCAAATTGCTGATGGGGTACGG - Intergenic
1113437505 13:110305099-110305121 CTTAATGTGCAGATGATGTATGG - Intronic
1113466607 13:110517854-110517876 GTGAATCTGCAGGTGGGGTGGGG - Intergenic
1113514605 13:110884103-110884125 CTGAATTTGAAAATGGAGTTTGG - Intronic
1113893389 13:113748334-113748356 GTGACTTTGCAGATGGGATTAGG - Intergenic
1118145276 14:63128142-63128164 CTGGATTAGCAGATGTGGTCTGG + Intergenic
1119406674 14:74403337-74403359 CTGAATTTGCAGCTGAGGGTAGG + Intergenic
1121612376 14:95290344-95290366 CAGACTTTGCAGATGTGTTAAGG + Intronic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122248553 14:100422096-100422118 CTGAATCTGCAGTTTGGGCAGGG + Intronic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126431680 15:48592261-48592283 CTGAACTTGGAGATGGGGGTGGG - Intronic
1128013864 15:64324635-64324657 CTCAGTTTGCAGATGGCCTATGG + Intronic
1128197803 15:65775917-65775939 CTGAATTTGCAAAGGTGGCATGG - Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1130811737 15:87386191-87386213 CTGAATTTAAAGATGTGATATGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1133394345 16:5434014-5434036 CTGAATTTTGAGTTGGGGTAGGG + Intergenic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1133713096 16:8420362-8420384 TTGAATTTGGAGATGGGGGCAGG + Intergenic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1134078530 16:11308973-11308995 CTGAATCTGCAGCTGTGGTTTGG + Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1136396857 16:29997326-29997348 ATGTATTTGCCTATGGGGTACGG - Intronic
1138121970 16:54407762-54407784 CTCATGTTGCAGATGGGGTTGGG - Intergenic
1139941401 16:70608461-70608483 CTGAAATTGCATATGGGATTAGG + Intronic
1140963440 16:79940700-79940722 GTGAATTTGGAGTTGGGATAAGG - Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1143315933 17:6033480-6033502 CTGAACCTGCAGGTGGGGGATGG + Intronic
1145994761 17:29098964-29098986 CTGGATCTGCAGGTGGGGTGGGG + Exonic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1147951708 17:44111259-44111281 CTGAAATAGCAGTTGGGGGAGGG + Intronic
1148632358 17:49121093-49121115 CTGAATTTGAAGAAGAGGAAGGG + Intergenic
1150547785 17:66179260-66179282 CTGAATCTGCAGATTGGTTTGGG + Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1153117665 18:1679135-1679157 CTGGCTTTGAAGATGGGGAAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1155509962 18:26566607-26566629 CTGAATTTGCAGTTTGAGGAGGG + Intronic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1162387474 19:10368521-10368543 CTGAAGCTGCAGGTGGGGGAGGG - Intronic
1163820886 19:19496038-19496060 GTGGATTTGCTGTTGGGGTAGGG - Exonic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1166130600 19:40743600-40743622 CCCAATTTCCAGATGGGGAAAGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925170758 2:1749058-1749080 CTGTATTTAAGGATGGGGTAGGG - Intergenic
925567951 2:5276991-5277013 CTGCATTCGCAGATGGTGTTAGG - Intergenic
925627266 2:5853762-5853784 CTGATTTTGCTGACGGGGTTAGG - Intergenic
925671289 2:6312181-6312203 CTGAATTTGCACCTGGGCTAAGG + Intergenic
925967792 2:9082363-9082385 CTGACTTTGAAAATGGGGGAAGG - Intergenic
927154223 2:20212508-20212530 CTGAGGCTGCAGATGGGGTCTGG + Intronic
929283203 2:40105863-40105885 CTGAATTACCAGATGTGGTCAGG - Intronic
929934570 2:46285475-46285497 GTGTATGTGCAGATGGGGTCTGG - Intergenic
930614524 2:53579486-53579508 CTGAAGCTGGGGATGGGGTAGGG - Intronic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931217182 2:60257047-60257069 CTGATTTTCCAGGTGGGGAAAGG + Intergenic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
933005503 2:76988403-76988425 CTGAATTAGCAGCTGGGTCAAGG - Intronic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
936823360 2:116551699-116551721 CTGAAATTGCAGAAGTGGAATGG - Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
940295658 2:152121495-152121517 CTGGATTGGGAGATGGGGAAGGG - Intronic
940733172 2:157418343-157418365 CTGTATTTGGAGGAGGGGTAAGG - Intronic
941067686 2:160921581-160921603 CTGAATCTGAAGATGGGATGGGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942045610 2:172097606-172097628 CAGAATTTGGAGCTGGGGTGCGG + Intergenic
942206032 2:173620675-173620697 GTGAATCTGCTGATGGGATATGG + Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
943791357 2:191935672-191935694 CTGAATTTGGAGATAGGTTGTGG - Intergenic
944008047 2:194935682-194935704 GTGAATTTTGAGGTGGGGTAAGG + Intergenic
948956771 2:241299147-241299169 CTGAATTTACAGAGGAGGTACGG - Intronic
1169338047 20:4773639-4773661 CTGATTCAGCAGATGGAGTAGGG - Intergenic
1169482720 20:5999898-5999920 CTGGCTTTGCAGATGAGGGAAGG + Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170199291 20:13725145-13725167 CTGCATGAGCAGATAGGGTAGGG - Intronic
1172185253 20:33027472-33027494 CTGAATTTAGAGCTGGGGTAGGG + Intergenic
1172995734 20:39069304-39069326 CTGAAATTGCAGGTTGGGAAGGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1177256071 21:18664104-18664126 CTGACTTTGAAGATGGGAAAAGG - Intergenic
1177769626 21:25500036-25500058 CAGAATTTGGGGATGGGGTCTGG + Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179612481 21:42561259-42561281 CTGAATTTTCAGATGGCATCTGG + Intronic
1183666604 22:39249819-39249841 GTGAATTTGCAAGTGAGGTAGGG - Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184869959 22:47231606-47231628 CTGGATTTGAAAATGGGGTGTGG - Intergenic
949262020 3:2114127-2114149 CAGAATTTTCAGATTGGGTTTGG + Intronic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
950856813 3:16113488-16113510 CTGCATTTCCAGATGGGTTTTGG - Intergenic
951796082 3:26539986-26540008 CTGATTTTGGAGATGGACTACGG + Intergenic
952150692 3:30586791-30586813 CTCAATTTCCAGTTTGGGTATGG + Intergenic
952241495 3:31534237-31534259 CCGAAGTTGCACATGGTGTAAGG + Intronic
953202463 3:40789709-40789731 CTGACTTTGAAGAAGGGGAAAGG + Intergenic
956135061 3:66090122-66090144 CTGGATGTTCAGTTGGGGTAGGG + Intergenic
957015860 3:75064386-75064408 CTGAATTTGTAGATTGCGTTTGG + Intergenic
957341921 3:78910918-78910940 CTGATTTAGCAGATGTGGGATGG - Intronic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958765214 3:98360031-98360053 CTGAATTTGAAGTTGGGGATAGG + Intergenic
959343385 3:105160454-105160476 CTGAAAGTGAAGATGTGGTATGG - Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963660968 3:148128781-148128803 CTCAACTTGCAGATGGCATATGG + Intergenic
965071349 3:163918457-163918479 CTCAACTTGCAGATGGCCTATGG + Intergenic
965143789 3:164871373-164871395 CTGTATTTGAAGATAGGGAAAGG - Intergenic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965272480 3:166636722-166636744 CTGCATTTGGAGATAGGGTAGGG - Intergenic
965734153 3:171803274-171803296 CTGAATTTGGGGATGTGGTTGGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
968598870 4:1499747-1499769 CTGAGTCTGCAGATGGGGACAGG - Intergenic
968715554 4:2156501-2156523 CTGAAAAGGAAGATGGGGTACGG + Intronic
968913203 4:3486055-3486077 CTGACTCTGCAGCTGGGGTCGGG + Intronic
969065305 4:4474706-4474728 CTGGTTTTGAAGATGGGGAAAGG + Intronic
970063079 4:12057705-12057727 CAGACTTTGCAGAAAGGGTATGG + Intergenic
970886599 4:20993558-20993580 CTGTATTTGAAGCTGAGGTAGGG - Intronic
971590665 4:28464904-28464926 TTTAATTTGCAGATGTGGTTTGG - Intergenic
971672692 4:29583429-29583451 CTGATTTTGGAGGTGGGGTCTGG - Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
975590852 4:75998387-75998409 CTAAATTTGTACATGTGGTAGGG + Intergenic
976670116 4:87642867-87642889 CTGAATTTGCAGTTCGGTTTGGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980705190 4:136484102-136484124 CTTTATTTGAAGATGAGGTATGG - Intergenic
981214060 4:142142504-142142526 CTGAACCTGGAGCTGGGGTAGGG + Intronic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
984564964 4:181318520-181318542 TTCAGTTTGCAGATGGCGTATGG - Intergenic
986016243 5:3760010-3760032 CTGAGTTGGCAGCTGGGGTATGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986312302 5:6560778-6560800 CTGAATTTGCAGATCGTTTAGGG - Intergenic
988655773 5:33210070-33210092 CTCAACTTGCAGATGGCCTATGG - Intergenic
989575709 5:42986349-42986371 CTCAATCTACAGATGGGGTCTGG + Intergenic
991072689 5:62502240-62502262 CTGAGGTTTCAGCTGGGGTAGGG + Intronic
992018320 5:72597805-72597827 CTGGATTTGCAGACAGGCTAAGG + Intergenic
992607640 5:78475590-78475612 CTGCATTTGCAGCTGCGGTCTGG - Exonic
993505987 5:88709003-88709025 CCGAAGTGGTAGATGGGGTATGG - Intergenic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996999393 5:129741213-129741235 CTGACATGGCAGAAGGGGTAAGG + Intergenic
997201068 5:132010671-132010693 CTGAATCTGCACATGGGGGTTGG + Intronic
997610285 5:135210964-135210986 CCCAAATTGCAGATGGGGAAGGG + Intronic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
998776962 5:145614386-145614408 CTGAATTTGCAGATTGCCTTTGG + Intronic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001214067 5:169838946-169838968 GTAGATTTGCAGTTGGGGTAGGG - Intronic
1001427723 5:171634929-171634951 CCGAATTTGCAGATGGGGGTTGG + Intergenic
1003576311 6:7299178-7299200 CTGAATTTTCTTCTGGGGTAGGG + Intronic
1004015730 6:11730242-11730264 ATGAATTTACAGGTAGGGTAAGG + Intronic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1006067374 6:31471731-31471753 CTGGATTTGGGAATGGGGTATGG + Intergenic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007565414 6:42846544-42846566 GAGAATTTGAAGCTGGGGTAAGG - Intronic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1014060300 6:117064030-117064052 CTCTATGTGCACATGGGGTAGGG - Intergenic
1014645197 6:123964716-123964738 CTGAGCTTCCAGATGGGGTTAGG - Intronic
1017200400 6:151747314-151747336 CTGAATAAGCAGATGGGTTGTGG + Intronic
1017625676 6:156346361-156346383 CTGAACCTGCAGCTGGGGTTGGG - Intergenic
1018606432 6:165602436-165602458 CTGAAATTGCACATGTGGAAGGG - Intronic
1018654045 6:166015430-166015452 CTCAACTTGCAGATGGCCTACGG + Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021253138 7:18356693-18356715 CGGTATTTGCACATGGGGGAGGG + Intronic
1022040660 7:26578490-26578512 ATGAATTTGGAGATGGGTTTGGG + Intergenic
1024589628 7:50870161-50870183 CTAATTTTGCAGATGGGAGAAGG + Intergenic
1025909834 7:65819508-65819530 CTGACTTTGAAGATGGAGTCAGG + Intergenic
1025978279 7:66386812-66386834 CTGACTTTGAAAATGGAGTAAGG - Intronic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1027943631 7:84717678-84717700 CTGGCTTTGAAGATGGGGAAGGG + Intergenic
1028598771 7:92577649-92577671 CTGATTCTGAAGATGAGGTAAGG - Exonic
1029511007 7:100995084-100995106 CTGAGGTTGCAGAGCGGGTAGGG - Exonic
1029511729 7:100999755-100999777 CTGAGGTTGCAGAGCGGGTAGGG - Exonic
1029512224 7:101003004-101003026 CTGAGGTTGCAGAGCGGGTAGGG - Exonic
1029642047 7:101827187-101827209 TTGACTGTGCAGGTGGGGTAGGG - Intronic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1032546679 7:132749552-132749574 ATCAATTTGCAGATGGGCCAAGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035832575 8:2713656-2713678 CTGAGTTTGAAGATGGGTAAAGG - Intergenic
1037060819 8:14507167-14507189 CTTGATTTGCAGATTGGATATGG - Intronic
1038341534 8:26690226-26690248 CTGAACTTGCAGATGGGGGTAGG + Intergenic
1039345352 8:36697911-36697933 CTGCATTTGCAGATTAGGTCTGG + Intergenic
1039741202 8:40384522-40384544 CTGATTTTGAAGATGGTGAATGG + Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040388939 8:46933367-46933389 CTGAATTGGCACCTGGGGGATGG - Intergenic
1040567125 8:48577392-48577414 AGGGATTTGGAGATGGGGTAAGG + Intergenic
1041288629 8:56286097-56286119 CTTAATTTGAAGCTGAGGTAAGG - Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042882902 8:73513883-73513905 CTGAGTCTGCAGGTGGGGGATGG + Intronic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1044696598 8:94929174-94929196 CTGAATCTGGTGATGGGGTGGGG - Exonic
1044854020 8:96456095-96456117 CTGAATTTACAAACAGGGTAAGG - Intergenic
1045315688 8:101041674-101041696 CTGAACTTGAAGGTGGGGTCTGG - Intergenic
1045607923 8:103799001-103799023 TTGAGTTTGAAGATGGGGGAAGG + Intronic
1045680562 8:104655253-104655275 TTTAATTTGCAGTTGGAGTAAGG - Intronic
1046049376 8:109003182-109003204 ATGAATTTGCAGTTTGGGCAAGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046837803 8:118822233-118822255 GTGAATTTTCAGCTGGGGTAGGG - Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049561031 8:143310389-143310411 CTGACTTGGCAGCTGGGGTGGGG - Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1052708674 9:32024675-32024697 CTGAATTTGCAGATTGCTTTTGG + Intergenic
1056483003 9:87024931-87024953 CTGAACTTGCAGCTGGTGTCTGG - Intergenic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1060103708 9:120860780-120860802 CTGAGTTTTCAGATGGGCTAGGG + Intronic
1062067272 9:134535515-134535537 CTGATTTTGCAGATGTAGTGGGG - Intergenic
1062135934 9:134928445-134928467 CTCAACTTGCAGATGGCCTATGG + Intergenic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186070857 X:5818308-5818330 ATAAATTTGCAGATTGGGAAGGG + Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187053493 X:15717680-15717702 CTAAATTTGCAGATGTGTTGAGG - Intronic
1187745034 X:22400101-22400123 ATGAATTTGCAGTTTGGGAAGGG - Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189007651 X:37011204-37011226 CAGCATGTGAAGATGGGGTATGG + Exonic
1189030993 X:37450293-37450315 CTCACTTTGCAGATGAGGAAAGG - Intronic
1189357106 X:40318383-40318405 CTGATCTTGCAGATGGGCTCTGG - Intergenic
1190756321 X:53405001-53405023 CTGAATCTGCAGGTGGGGCCTGG - Exonic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1193258187 X:79375036-79375058 CTGATTTTGTATATGGTGTAAGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195302046 X:103539554-103539576 TTGAATTTGAAGGAGGGGTAGGG - Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1196469092 X:116005136-116005158 TTGATTTTGGAGGTGGGGTATGG + Intergenic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197140651 X:123114215-123114237 CTGGATTTGAAGATGAGGGAAGG - Intergenic
1198016133 X:132613154-132613176 GTGACTGTGCAGATGGTGTATGG - Intergenic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1200843575 Y:7808690-7808712 CAAAATTTTCAGATGTGGTAGGG - Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201510690 Y:14758247-14758269 CTGTATTTGCAAATGGATTAAGG + Intronic