ID: 903130977

View in Genome Browser
Species Human (GRCh38)
Location 1:21279373-21279395
Sequence CTCCAAGGGAAGCGGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 280}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903130977_903130996 21 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130996 1:21279417-21279439 CAGGCCCTGGAGAGGCATCAGGG 0: 1
1: 0
2: 4
3: 55
4: 477
903130977_903130988 -4 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130988 1:21279392-21279414 GGAGGAAGGGGTTCCGCTGCAGG 0: 1
1: 0
2: 1
3: 22
4: 214
903130977_903130992 13 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130992 1:21279409-21279431 TGCAGGCCCAGGCCCTGGAGAGG 0: 1
1: 0
2: 5
3: 67
4: 685
903130977_903130989 2 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130989 1:21279398-21279420 AGGGGTTCCGCTGCAGGCCCAGG 0: 1
1: 1
2: 1
3: 15
4: 210
903130977_903130995 20 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130995 1:21279416-21279438 CCAGGCCCTGGAGAGGCATCAGG 0: 1
1: 0
2: 1
3: 59
4: 456
903130977_903130990 8 Left 903130977 1:21279373-21279395 CCCGGGCCCCGCTTCCCTTGGAG 0: 1
1: 1
2: 4
3: 27
4: 280
Right 903130990 1:21279404-21279426 TCCGCTGCAGGCCCAGGCCCTGG 0: 1
1: 0
2: 5
3: 62
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903130977 Original CRISPR CTCCAAGGGAAGCGGGGCCC GGG (reversed) Intronic
900212268 1:1461949-1461971 CTCCAGGTGATGAGGGGCCCTGG + Intronic
900224940 1:1528600-1528622 CTCCAGGTGATGAGGGGCCCTGG + Intronic
900574912 1:3378344-3378366 TGCCAAGGGAAGCAGGGACCGGG + Intronic
900616089 1:3566307-3566329 CTCCATGGGAAGGGGGGCATGGG + Intronic
900950564 1:5856126-5856148 CTCCAAGGCATGTGGGGCCCTGG - Intergenic
901207010 1:7503207-7503229 CTCCAAGGGCAGCAGAGCCCGGG - Intronic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
901634711 1:10665149-10665171 CTCCAAGGACGGCGGTGCCCTGG - Exonic
901811976 1:11772560-11772582 CTTAAAGGGAAGTGGGGGCCAGG - Intronic
903130977 1:21279373-21279395 CTCCAAGGGAAGCGGGGCCCGGG - Intronic
903269365 1:22178037-22178059 CCCCAAGGAAAGCAGGGTCCTGG - Intergenic
903560169 1:24221106-24221128 CTGCTAGTGAAGAGGGGCCCCGG + Intergenic
903734633 1:25522380-25522402 CCCCTAGGGAAGCGGATCCCAGG + Intergenic
904624493 1:31794293-31794315 CTCCATGGGTAGGGGGCCCCAGG + Intronic
904772299 1:32886938-32886960 CTCCGAGGGTGGCAGGGCCCAGG + Intronic
907091625 1:51730146-51730168 CTCCCAAGGAAGAGGGGCCCGGG - Intronic
907247442 1:53117013-53117035 CCGCAAGGGAAGCGGGGACAAGG + Intronic
907277783 1:53326710-53326732 CCCCGAGGGAGGCGGTGCCCAGG + Intronic
907912337 1:58837521-58837543 CTCCATGGGAATTGGAGCCCAGG - Intergenic
914875547 1:151511023-151511045 CTCCAAGGGAATCGCCGGCCAGG - Intronic
916889616 1:169103536-169103558 CTCCAAAGGGAGGGGTGCCCCGG - Intergenic
917508412 1:175649650-175649672 CTCCCATGGAACCGGGGGCCGGG - Intronic
917968008 1:180190635-180190657 CTCCAAGGGGAGAGGGGGCAGGG + Intronic
922790118 1:228306644-228306666 CTCCCAGGCTAGCGTGGCCCAGG + Intronic
922797095 1:228345593-228345615 GTCCAAAGGGAGCGGGGCTCAGG - Intronic
924384993 1:243492021-243492043 CACCAGGGGCAGCGGGGCTCAGG - Intronic
1063367680 10:5500943-5500965 CTCCAAGGGAAGCCGGAGGCTGG + Intergenic
1063420825 10:5911433-5911455 TTCCTAGGGAAGCGAGGCCACGG - Intronic
1064395906 10:14981832-14981854 AAGCAAGGGAAGGGGGGCCCTGG - Intronic
1064397603 10:14994019-14994041 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1069438547 10:68407335-68407357 CCCCAGGGGGAGCGGCGCCCCGG + Intergenic
1069581310 10:69568965-69568987 CACAAAGGTAGGCGGGGCCCGGG - Intergenic
1069616625 10:69810705-69810727 CTCCAAGGGAAACTGAGGCCTGG + Intronic
1069739327 10:70677565-70677587 CACCAAGGGGAGGGGGACCCAGG - Intronic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1073922148 10:108471154-108471176 TTCCAAGGCAAGGGGGCCCCTGG + Intergenic
1074280659 10:112048608-112048630 CTCCAAGGGTAGTGGGTCCTGGG - Intergenic
1074372136 10:112908685-112908707 GTCTAGGGGAAGCGGGGCCCAGG + Intergenic
1075078583 10:119368082-119368104 CTCCAGGGGAAGCCAGACCCCGG + Intronic
1075399469 10:122150623-122150645 AACCAAGGGAGGCAGGGCCCAGG + Intronic
1076418374 10:130309037-130309059 CTCCAAGGGTAGCTGAGACCTGG + Intergenic
1077158251 11:1101087-1101109 ACCCAAGGGAAGCCGTGCCCTGG - Intergenic
1077341904 11:2029989-2030011 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1077553381 11:3214126-3214148 CTCCCAGGGAAACGGAGCCAAGG - Intergenic
1077589363 11:3479758-3479780 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1077634488 11:3832937-3832959 CTACTAGGGAGGCTGGGCCCAGG + Intronic
1077962431 11:7089545-7089567 CTTCATGGGCATCGGGGCCCTGG - Exonic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1083888734 11:65585309-65585331 CTCCAAGGACGGCGGGGCCGAGG + Exonic
1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG + Exonic
1084228086 11:67729995-67730017 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1084284045 11:68120624-68120646 ATCCAAGGGAAGCGGGTTCGCGG - Intronic
1084725215 11:70937392-70937414 CTCTCAGGGAAGCGAGGTCCTGG - Intronic
1084807139 11:71586870-71586892 AGGCAAGGGAAGGGGGGCCCTGG + Intronic
1084811160 11:71612432-71612454 AAGCAAGGGAAGGGGGGCCCTGG + Intergenic
1084827607 11:71743045-71743067 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
1085127449 11:74011317-74011339 CCCCAAGGGAAGTGGGGCCCTGG + Intergenic
1087713745 11:101583523-101583545 CTCCCCCGGGAGCGGGGCCCAGG - Exonic
1089582394 11:119489534-119489556 CTGCAGGAGAAGCAGGGCCCTGG + Intergenic
1089690039 11:120181512-120181534 CTCCTAAGGAAGAGGGTCCCCGG + Intronic
1089750323 11:120647150-120647172 CTCCAAGGGAAGCAGAGCCCTGG - Intronic
1089778576 11:120856926-120856948 GTCTAGGGGAAGCAGGGCCCCGG - Intronic
1090385475 11:126355667-126355689 CTGCAGGGGAGGCGGGGACCCGG - Intronic
1090422882 11:126587895-126587917 CTCTAAGGAGAGCTGGGCCCTGG + Intronic
1091108672 11:132944756-132944778 GCCCAAGGGAAGCGGAGCTCTGG - Intronic
1202824890 11_KI270721v1_random:85178-85200 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1091383572 12:78089-78111 CGCGAAGGGAAGCGCGGCCCGGG + Intronic
1091653158 12:2324536-2324558 CTCCTGGGGAGGCGGGGCCCGGG - Intronic
1091692677 12:2607627-2607649 CTGCAGAGGAAGTGGGGCCCGGG - Intronic
1092415655 12:8288663-8288685 AGGCAAGGGAAGGGGGGCCCCGG - Intergenic
1092432773 12:8422245-8422267 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1092435370 12:8442881-8442903 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1095838858 12:46669850-46669872 CTGCAAGGGCAGCAGAGCCCTGG + Intergenic
1096244052 12:49974573-49974595 CTCCAAGGCACGAGGGGCTCAGG - Intronic
1096409662 12:51367993-51368015 CTCCAGGGGAAGTGAGGCCATGG + Intronic
1099201143 12:79678751-79678773 CTCCAAGTGAAGAGGGGAACAGG - Intronic
1103283834 12:119783875-119783897 CTCCAAGGGAAGGGGGCTTCAGG + Intronic
1103763390 12:123266527-123266549 CTCCAAGGGATGAGCCGCCCCGG - Intronic
1103904723 12:124321440-124321462 CTCCAGGGGAGGCAGGACCCTGG + Intergenic
1106115563 13:26814887-26814909 CTCCCACGGGAGCAGGGCCCCGG - Intergenic
1107544537 13:41423774-41423796 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1119323353 14:73744460-73744482 CTCCAAGGGCAGGGGGCCCTCGG - Intronic
1121098512 14:91234048-91234070 CTCCGGGAAAAGCGGGGCCCAGG - Exonic
1122235519 14:100328932-100328954 CTACAAGGGCAGCTCGGCCCTGG + Exonic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1122898317 14:104771520-104771542 CTCCAAGGGTATGGGGGGCCTGG - Intronic
1124373721 15:29117484-29117506 CTCCGAGGGACGCGGCTCCCGGG + Exonic
1128706131 15:69838500-69838522 CTCCTAGGGAAGAGGGGTGCAGG - Intergenic
1128741807 15:70088978-70089000 CTGCAAGGGCAGAGGGGCCTTGG + Intronic
1128761359 15:70218120-70218142 CTCCAGGGGCAGTGGGGTCCAGG - Intergenic
1130649081 15:85751885-85751907 CTCAAAGGGAAGCAGTGACCAGG - Intergenic
1131873046 15:96780103-96780125 CCCCAAGGGAAGTGGGCACCTGG + Intergenic
1132179095 15:99738244-99738266 CTCCAAGGGAGGTCGGGCACAGG - Intergenic
1132696734 16:1205281-1205303 CTCCCCAGGAAGAGGGGCCCGGG + Intronic
1132743370 16:1426923-1426945 CACCAAGGAGAGCAGGGCCCCGG - Intergenic
1132896477 16:2231738-2231760 CTCCGATGGAAGAGTGGCCCCGG + Intronic
1133118424 16:3591422-3591444 TTCAAAGGGAAGCAGGGCCTGGG - Intronic
1133212776 16:4272473-4272495 CTCCAAGGAAGGAGGGTCCCGGG + Intronic
1134492175 16:14703442-14703464 ATCCCAGGGCCGCGGGGCCCGGG + Intergenic
1134497556 16:14742564-14742586 ATCCCAGGGCCGCGGGGCCCGGG + Intronic
1136153053 16:28364802-28364824 CTCCCAGGGCCGCAGGGCCCGGG - Intergenic
1136210030 16:28750471-28750493 CTCCCAGGGCCGCAGGGCCCGGG + Intergenic
1136413798 16:30091656-30091678 CTCCAAGTGAAGGGGGGCGGAGG - Intronic
1136637940 16:31537596-31537618 CTCCACGGGAGGCCGGTCCCAGG - Intergenic
1136638198 16:31539328-31539350 CTTCAAGGGATGTGGGGACCTGG + Intergenic
1138230284 16:55331399-55331421 CTCGCAGGGAAGCAGGGACCCGG + Intergenic
1140256953 16:73345863-73345885 GCCCTAGGGAAGCAGGGCCCTGG - Intergenic
1140872700 16:79121667-79121689 CGCCAAGGGAAGCTGGGCTTTGG + Intronic
1140913824 16:79477273-79477295 CTTCAAGAGAAGCAGGACCCTGG + Intergenic
1141448543 16:84080585-84080607 CCCCAGGGGAAGCGTGGCCTTGG - Intronic
1141907800 16:87039102-87039124 CTCCAAGGGAAGCTGAGCCCAGG - Intergenic
1141959106 16:87392603-87392625 GGCCGAGGGATGCGGGGCCCGGG + Intronic
1142176321 16:88647052-88647074 CTCCGGGGGCTGCGGGGCCCAGG - Intronic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1142590261 17:1001731-1001753 CTCCCAGGGAAGCGGGGGATGGG + Exonic
1142638634 17:1272249-1272271 CTCCCAGGGAACCGTGGGCCAGG + Intergenic
1142799537 17:2336968-2336990 CTCCGTGGGAGGCGGGGCGCAGG - Exonic
1143773860 17:9185296-9185318 CCCCCTGGGAAGCGGGGCCCGGG + Intronic
1143863096 17:9905330-9905352 CTTGAAGGGAGGAGGGGCCCAGG + Exonic
1144494780 17:15739200-15739222 CTAGAAAGGATGCGGGGCCCCGG + Intronic
1144905473 17:18637472-18637494 CTAGAAAGGATGCGGGGCCCCGG - Intronic
1145060345 17:19729319-19729341 ATCCAAGGGAAGCTGGGACTGGG - Intergenic
1145279306 17:21456249-21456271 CTCACGGGGCAGCGGGGCCCTGG + Intergenic
1145865222 17:28236866-28236888 AGGCAAGGGAAGGGGGGCCCCGG - Intergenic
1145924134 17:28633237-28633259 CTCCATGGGATGAGGGGCTCAGG - Intronic
1146495337 17:33317204-33317226 CTGCAAGGGAAGCAGGCCTCAGG - Intronic
1146913746 17:36665021-36665043 CTCCAAAGCTAGCGGCGCCCAGG - Intergenic
1147590835 17:41682472-41682494 CTCCAAGGAACCAGGGGCCCAGG - Intergenic
1148139333 17:45317107-45317129 CTCCGGGGGAGGCGTGGCCCCGG - Intergenic
1148483932 17:47978454-47978476 CTCTAGGGGGATCGGGGCCCTGG + Intronic
1148744828 17:49912328-49912350 CTCCCAGGGGACAGGGGCCCAGG + Intergenic
1149594424 17:57855821-57855843 CTCAAAGGAAAGCTGGGCCTGGG - Intergenic
1149998414 17:61416924-61416946 CTCCCAGGGAAGCGCGGCCAGGG + Intergenic
1150501439 17:65654494-65654516 CTCCAAGGCAAGCGGGTGGCTGG + Intronic
1150654379 17:67030443-67030465 CTGAAAGGGAAGCGGGGAGCGGG - Intronic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1152086745 17:78224518-78224540 CTCCAAAGAAAGCGGGGACCTGG - Exonic
1152112829 17:78366513-78366535 CTCCAAGGGCGCCTGGGCCCAGG - Intergenic
1152125612 17:78444894-78444916 CTCCGAGGAAACCGGGGCTCTGG + Intronic
1152407778 17:80107460-80107482 CTCCCAGGGCACCAGGGCCCGGG + Intergenic
1152570588 17:81119716-81119738 CTGCATGGGAGGCGGGGCCTGGG - Intronic
1152584183 17:81181780-81181802 CTGCAAGGCCAGCGGGGACCCGG - Intergenic
1152699562 17:81812281-81812303 CGCCAAGGGAGGAGGGGCCTGGG - Intronic
1152735868 17:81996500-81996522 TTCCAAGGGAAGTGGAGCGCTGG - Exonic
1152777557 17:82212486-82212508 CTCCCGGGGCTGCGGGGCCCTGG + Intronic
1153894928 18:9550036-9550058 CTGCCAGGTAAGCGAGGCCCTGG - Exonic
1154358639 18:13641724-13641746 CGGCAAGGGGAGCGGGGCGCTGG + Intronic
1157386104 18:47261018-47261040 CTCCAAAGGAAGGGAGGCCGAGG + Intergenic
1157612816 18:48968988-48969010 CTCCAAGGGGGGCCGGGCCGGGG - Intergenic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160121578 18:76135066-76135088 CTGCATGGGCAGCGGGGCCCAGG - Intergenic
1160691874 19:464009-464031 CTCCAGGGGTCGCGGGGCCCGGG + Exonic
1160732836 19:649080-649102 CTCCAAGGGGCCCAGGGCCCAGG - Intronic
1161965371 19:7544881-7544903 CTCCCAGATAAGCAGGGCCCAGG - Intronic
1162490123 19:10986766-10986788 CCCCAGGGGAAGCGGGGAGCTGG - Intronic
1163597060 19:18226363-18226385 CCCCGAGGGGAGCCGGGCCCGGG + Intronic
1164972583 19:32545177-32545199 CTCCATGGGCAGCTGGGTCCAGG + Intergenic
1165353741 19:35291435-35291457 TTCCCAGGGAAGCGGCACCCAGG + Intergenic
1165459465 19:35936283-35936305 CTCCATGGGAGGTGGGGCCGGGG + Intronic
1165764582 19:38342869-38342891 CTCCCAGGGATGCGGGATCCTGG - Intronic
1167207714 19:48113712-48113734 CTGCACGCGGAGCGGGGCCCAGG - Intergenic
1167504482 19:49863877-49863899 CTCCAGGGTAAGCGGGGCGGAGG - Intronic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1168076309 19:53982510-53982532 CTCCAAGGGCAGCGTGGCCGCGG + Exonic
925361045 2:3280513-3280535 CTCCAGGGGAAGAGGGGCTCTGG + Intronic
927207021 2:20617260-20617282 CAGCAAGGGATGCAGGGCCCGGG + Intronic
927846766 2:26476295-26476317 CTGCCAGGGAAGCGGGGCTTCGG - Exonic
927893095 2:26764563-26764585 ACCCAAGGGATGCGAGGCCCGGG + Intronic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929557913 2:42936954-42936976 CTCCAAAGCATGAGGGGCCCAGG - Intergenic
929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG + Intergenic
930722044 2:54647217-54647239 CTCCAAGACCAGCCGGGCCCTGG + Exonic
932349552 2:71021248-71021270 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
933354678 2:81196743-81196765 CTCCACGGGAACCGGGGGCAGGG + Intergenic
935598264 2:104896755-104896777 CTCCAGGAGAGGCGGGGCACAGG - Intergenic
936556913 2:113503919-113503941 GTCCAAGGGGCGCGGGGGCCGGG + Intergenic
940622106 2:156125158-156125180 CTGAAAGGGAAGTGGGGCACCGG - Intergenic
940874048 2:158883034-158883056 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
945066252 2:205949846-205949868 CCCCCAGGGAAGCCTGGCCCAGG + Intergenic
945102461 2:206274806-206274828 CTCCGCGGGCAGCGGGGCCGTGG + Exonic
1169343040 20:4810612-4810634 CTCCAAGGGAGGGGCAGCCCTGG + Intronic
1169488971 20:6055627-6055649 CTCCCAGGGAGCCTGGGCCCAGG + Intergenic
1169733429 20:8811303-8811325 CTCGAAGGGAAGCAGGGATCTGG + Intronic
1172530260 20:35626229-35626251 CTCCAAGGGAACCTAGGCCTGGG + Exonic
1173173907 20:40749821-40749843 GTCCAGGGGAAGCTGGGTCCAGG - Intergenic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1174575479 20:51533987-51534009 CTCCAAGGCAGGAGGGCCCCAGG - Intronic
1174870128 20:54174086-54174108 CTCCGAGGGACGCGGGACCCAGG + Intergenic
1175712531 20:61232571-61232593 CTTCAAGGGAGGCTGGGCCTGGG + Intergenic
1175916045 20:62426452-62426474 CTCCAAGGCCAGGTGGGCCCCGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176019983 20:62957574-62957596 CTCCAAGGTAAGGGGAGCTCAGG + Exonic
1176063477 20:63182400-63182422 CTCCAGGGGAAGCTGAGGCCAGG + Intergenic
1176281603 20:64316692-64316714 CGCGAAGGGAAGCGCGGCCCGGG - Intergenic
1176981122 21:15382260-15382282 CTCCAGAGGAAGTGTGGCCCTGG - Intergenic
1178295871 21:31409636-31409658 CTGCAAGGGAAGCGGGCCTGTGG - Intronic
1179225755 21:39451707-39451729 GGCCAAGGGAGGTGGGGCCCCGG - Intronic
1179570418 21:42275310-42275332 CGCCCAGGGATGCTGGGCCCAGG - Intronic
1180181585 21:46120700-46120722 CCCCAAGGTAAGGGGGGCCCAGG + Intronic
1181167774 22:20992651-20992673 CCCCAAGGGATGAGGGCCCCTGG - Intronic
1183508197 22:38220823-38220845 CTTCAACAGAAGCGGTGCCCAGG + Exonic
1183521539 22:38298580-38298602 CACCATGGGCAGCAGGGCCCAGG - Intronic
1183613540 22:38927377-38927399 CGCCAGGGGACGCAGGGCCCAGG - Intergenic
1184347826 22:43924168-43924190 CCCCAGGGGTCGCGGGGCCCTGG + Intronic
1184429033 22:44430451-44430473 CTCCATGGGCAGCGGGACCCTGG - Intergenic
1185187879 22:49413727-49413749 CCCCAGGGGCAGCGGGGCTCAGG - Intergenic
1185192947 22:49450287-49450309 GTCCAGGGGAGGCGGGGCGCGGG + Intronic
949343667 3:3056053-3056075 TTCAAAGGGAAGAGGGGCCACGG - Intronic
949535709 3:4994972-4994994 CCCCAGGGGAAGCAGGGGCCAGG - Intergenic
949882665 3:8674211-8674233 AAGCAAGGGAAGGGGGGCCCTGG + Intronic
949974702 3:9445342-9445364 CTCCAAAGGAAGAGGAACCCGGG + Intronic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
954103700 3:48397881-48397903 CTCCAAGGGACCCAGGGACCCGG + Intronic
957044771 3:75365060-75365082 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
957076553 3:75607248-75607270 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
961271896 3:125695700-125695722 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
961274736 3:125717933-125717955 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
961893202 3:130147272-130147294 AGGCAAGGGAAGGGGGGCCCCGG - Intergenic
962049372 3:131796615-131796637 CTCCAGGGGAAGGGGGACCCTGG - Intronic
968656254 4:1779645-1779667 CTCCCAGGGAATGGGGGCCGGGG + Intergenic
968920663 4:3520860-3520882 CCCCTAGGGAAGCGGGGCTAGGG - Intronic
969020013 4:4133543-4133565 AAGCAAGGGAAGGGGGGCCCTGG - Intergenic
969490869 4:7498596-7498618 CTCCTAGGGACGCAGGGCCTGGG + Intronic
969729108 4:8943218-8943240 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
969733843 4:8973870-8973892 AAGCAAGGGAAGGGGGGCCCTGG + Intergenic
969749560 4:9099865-9099887 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
969785279 4:9452753-9452775 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
969826317 4:9761293-9761315 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
972217801 4:36916625-36916647 CTCAAACGGAAGCAGGGCTCTGG - Intergenic
972725855 4:41746062-41746084 CTCCGGGGGCGGCGGGGCCCGGG - Exonic
980749965 4:137076212-137076234 CTGCAAGGGAAGCAGGGAACTGG - Intergenic
981285976 4:143019786-143019808 CTCCCAGGGAAGTGGTGCCTTGG - Intergenic
981604632 4:146528301-146528323 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
982240668 4:153296419-153296441 CTCCCAGGGAAGAGGGGCGTTGG - Intronic
984928280 4:184825722-184825744 TGCCGAGGGAAGCGGGGCCGCGG + Intronic
985580497 5:693262-693284 CTCCAAGGTAAGCGGGCGCGGGG - Exonic
985595155 5:784652-784674 CTCCAAGGTAAGCGGGCGCGGGG - Intergenic
985908889 5:2863861-2863883 CTCGAAGGGAACCCGTGCCCAGG - Intergenic
987038518 5:14040638-14040660 CTCCACACTAAGCGGGGCCCAGG + Intergenic
990803159 5:59628638-59628660 CTCCAAGACAAGTAGGGCCCTGG + Intronic
992151011 5:73903107-73903129 GTCCAAGGGAAGCGGAGGTCTGG + Intronic
995574077 5:113511627-113511649 CCCCAAGAGAAGCAGGGCTCAGG + Intergenic
995903294 5:117094162-117094184 CCCAAAGCGAAGTGGGGCCCTGG - Intergenic
997710102 5:135996896-135996918 CTTCTAGGGAAGCCGGGTCCTGG - Intergenic
999452026 5:151685858-151685880 CTCCAAGGGAAGGGGGGCACTGG - Intronic
1000277801 5:159754454-159754476 CTCTGAGGGAAGAGTGGCCCAGG + Intergenic
1001680180 5:173550963-173550985 CTCCAAGGGCAGCGAGACCCTGG - Intergenic
1003632802 6:7803143-7803165 CTCCCAGGGAAGAGTGGCGCAGG + Intronic
1004554284 6:16680517-16680539 CTTCAAGGGAAGAAGGACCCAGG + Intronic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1007717514 6:43865820-43865842 CTGCAAGGGATGTGGGGCCAAGG + Intergenic
1010360421 6:74987013-74987035 TTCACAGGGCAGCGGGGCCCTGG - Intergenic
1011705154 6:89993753-89993775 CTCCAAGGACACCAGGGCCCAGG + Intronic
1016581887 6:145637437-145637459 CTGCAGGGGAAGCAGGGCTCAGG - Intronic
1018390034 6:163335234-163335256 CCCCAAGGGAGGCGTGGCTCAGG - Intergenic
1018544482 6:164919590-164919612 CTTCAAGGGAAGCCTGGCACTGG + Intergenic
1018751848 6:166813256-166813278 CTTCCAGGGAATCGGAGCCCTGG - Intronic
1019142590 6:169957606-169957628 CCACAAGGGACACGGGGCCCAGG - Intergenic
1019194278 6:170272191-170272213 CCCCAGGGGAAGTAGGGCCCGGG + Intergenic
1019275721 7:174528-174550 AACCAAGGGAAGCCAGGCCCTGG + Intergenic
1019918657 7:4149485-4149507 CTCCCCGGGGAACGGGGCCCTGG + Intronic
1020311890 7:6874404-6874426 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1023686004 7:42736443-42736465 GTGCAAGGGAAGCGGGAGCCAGG + Intergenic
1023860426 7:44214915-44214937 CTCCCAGGGAGGCGGGCCCAAGG + Intergenic
1024404320 7:48961173-48961195 CTTCTAGGGAATTGGGGCCCTGG - Intergenic
1024539430 7:50464030-50464052 CTGCTATGGAAGCAGGGCCCAGG - Intronic
1026863635 7:73809802-73809824 CTCCCAGTGAAACCGGGCCCTGG - Intronic
1026976715 7:74503188-74503210 CTCCCTGGGCAGCGGGGCCCTGG - Intronic
1029078546 7:97954517-97954539 AAGCAAGGGAAGGGGGGCCCTGG - Intergenic
1029105112 7:98168373-98168395 CTGGGAGGGAAGCGAGGCCCCGG + Intronic
1030130571 7:106195969-106195991 ATCCGAGGGAAGAGGGGTCCAGG - Intergenic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1034500435 7:151447345-151447367 CTTCAAGTGAAGCAGGGACCAGG + Intergenic
1034501103 7:151451671-151451693 CACCAAGGGGAGGGAGGCCCTGG + Intergenic
1036239467 8:7069961-7069983 AGGCAAGGGAAGGGGGGCCCTGG + Intergenic
1036372634 8:8174208-8174230 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
1036816983 8:11909655-11909677 AGGCAAGGGAAGGGGGGCCCCGG - Intergenic
1036820287 8:11934544-11934566 GGGCAAGGGAAGGGGGGCCCCGG - Intergenic
1036878270 8:12491433-12491455 AGGCAAGGGAAGGGGGGCCCCGG - Intergenic
1036906352 8:12711236-12711258 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1038798745 8:30731012-30731034 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
1045437040 8:102173824-102173846 TGCCCAGGGCAGCGGGGCCCTGG + Intergenic
1045552834 8:103187742-103187764 CTCTAAGGGAAGAAGGACCCAGG - Intronic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1049748928 8:144274474-144274496 CTCCAAGGGAACAGAGGCCCAGG + Intronic
1049896087 9:113382-113404 GTCCAAGGGGCGCGGGGGCCGGG - Intergenic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1056712335 9:89001116-89001138 TTCAAAGGGAAGCGGGGCTGAGG - Exonic
1056917553 9:90758397-90758419 AGGCAAGGGAAGGGGGGCCCTGG - Intergenic
1057039852 9:91840132-91840154 CTCCCAGGACAGCGGGGCCTCGG - Intronic
1057623212 9:96655050-96655072 CTGGAAGGGAAGCGCGGCCCAGG - Intronic
1059942135 9:119369008-119369030 GTCCAAGGGCAGCGGGGCTGCGG + Intronic
1061074640 9:128333678-128333700 CTCCAAGGGAAGCAGGGGATGGG - Exonic
1061387901 9:130301230-130301252 GGCCAAGGGAAGAGAGGCCCCGG - Intronic
1061593353 9:131613174-131613196 CACAGAGGAAAGCGGGGCCCAGG + Intronic
1061824987 9:133252414-133252436 CCCCCAGGGAGGCGGGGCGCAGG + Intronic
1061861033 9:133468963-133468985 CTCCAGGGGAAGCTGCTCCCAGG - Exonic
1061892891 9:133632017-133632039 CTCCCAGGGAAGCAGAACCCAGG - Intergenic
1062082840 9:134633570-134633592 CAGCAAGGGCAGCGGTGCCCAGG - Intergenic
1062384824 9:136305031-136305053 TTCCAAGCCAAACGGGGCCCTGG + Intronic
1062483334 9:136762512-136762534 CTCAAGGGGTAGTGGGGCCCAGG - Intronic
1189142271 X:38619234-38619256 CTCCAATGCAATGGGGGCCCTGG - Intronic
1189376855 X:40473397-40473419 CTCCAAGGTCAGCAAGGCCCCGG - Intergenic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1189684511 X:43549984-43550006 CTCCAACAGAAGTGAGGCCCAGG + Intergenic
1193085044 X:77441443-77441465 CTCCAAGGAAACTGAGGCCCCGG - Intergenic
1194400177 X:93432096-93432118 AGGCAAGGGAAGGGGGGCCCCGG + Intergenic
1196734888 X:118974764-118974786 CTCCATGGGAAGAGGGACACGGG - Exonic
1200179249 X:154140485-154140507 CCCCAAGGAAAGAGGGCCCCTGG - Intergenic
1200902882 Y:8450731-8450753 CCCCAATGGAAGCAGGGTCCAGG - Intergenic