ID: 903131167

View in Genome Browser
Species Human (GRCh38)
Location 1:21280360-21280382
Sequence ATAAAGAAACAGACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 585}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903131156_903131167 23 Left 903131156 1:21280314-21280336 CCAACTCAGGGCCATGCTGGAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG 0: 1
1: 0
2: 4
3: 50
4: 585
903131162_903131167 -8 Left 903131162 1:21280345-21280367 CCAGCAGGGAGGCAGATAAAGAA 0: 1
1: 0
2: 1
3: 28
4: 370
Right 903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG 0: 1
1: 0
2: 4
3: 50
4: 585
903131161_903131167 -7 Left 903131161 1:21280344-21280366 CCCAGCAGGGAGGCAGATAAAGA 0: 1
1: 0
2: 0
3: 33
4: 422
Right 903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG 0: 1
1: 0
2: 4
3: 50
4: 585
903131157_903131167 12 Left 903131157 1:21280325-21280347 CCATGCTGGAAATACACAGCCCA 0: 1
1: 0
2: 2
3: 17
4: 174
Right 903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG 0: 1
1: 0
2: 4
3: 50
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903131167 Original CRISPR ATAAAGAAACAGACTGGGGT GGG Intronic
900101006 1:962087-962109 TCAAAGACAAAGACTGGGGTGGG - Intronic
901030165 1:6302525-6302547 GTGAAAACACAGACTGGGGTGGG - Intronic
901624002 1:10613254-10613276 ATAAAGAAACAGAGTCATGTTGG + Intronic
901723193 1:11217148-11217170 ATAAGCAAGCAAACTGGGGTAGG + Intronic
902229628 1:15019677-15019699 ATGAAGAAACTGGCTGGGCTTGG - Intronic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902834324 1:19036863-19036885 AGCAAGAGACAGGCTGGGGTGGG - Intergenic
903124930 1:21241324-21241346 AAAAAGAAACAGACTGGGTGCGG - Intronic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903410164 1:23136209-23136231 TTAAAGAAACAGACAGGGCCAGG + Intronic
903632790 1:24789225-24789247 ATATAGAAACAGGCTGGGCGAGG + Intronic
903788770 1:25878437-25878459 TTACACAAAAAGACTGGGGTGGG - Intergenic
903802299 1:25978269-25978291 ATATAGAAAAAGACAGGGGTAGG - Intronic
904258610 1:29273696-29273718 ATAAATAAAGAAACTGGGCTGGG - Intronic
904505723 1:30951807-30951829 ATAATGAAACATACTGGAGTCGG + Intronic
906518800 1:46455491-46455513 ATGGAGTAACAGACTGGGCTTGG + Intergenic
906631555 1:47373499-47373521 TTAAAGAAACATACAGGGCTGGG + Intronic
907000435 1:50847269-50847291 AAAAAAAAACAGACTGAGATAGG + Intronic
907157488 1:52347739-52347761 AAAAAAAAACAGGGTGGGGTTGG - Intronic
907199009 1:52710085-52710107 GTAAAGAAACAGACACGGCTGGG + Intergenic
907251561 1:53142983-53143005 ATAAAGAAACTGAGGTGGGTGGG + Intergenic
907629949 1:56070511-56070533 ATAATTAAACAAACTGGGTTAGG - Intergenic
908289866 1:62654580-62654602 ACATATAATCAGACTGGGGTAGG + Intronic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
909005963 1:70276857-70276879 AAAAAGAAAGAAAGTGGGGTGGG + Intronic
912998233 1:114553168-114553190 ATCAAGAAACAAAGTGGGGAAGG + Intergenic
913062495 1:115220988-115221010 ATAAAGAGAGAGAGTGGGGGTGG + Intergenic
913384643 1:118246111-118246133 AAAAAGAAACAGACATTGGTAGG + Intergenic
914205122 1:145520175-145520197 ATACAGAAACAGCCTGTTGTAGG - Intergenic
914454483 1:147823203-147823225 ATTAAGTACCAGATTGGGGTGGG - Intergenic
914560267 1:148811262-148811284 TTTAAGAAACAGACTTGGCTGGG - Intronic
914612566 1:149318953-149318975 TTTAAGAAACAGACTTGGCTGGG + Intergenic
915183630 1:154084792-154084814 AAAAAAAAAAAGGCTGGGGTTGG + Intronic
915515935 1:156412781-156412803 AGAAAGAAAGAGGCAGGGGTAGG - Intronic
915790538 1:158665285-158665307 ATAAAGTAAAAGACTGGAGTAGG - Intronic
916028027 1:160852121-160852143 AAAAAGCAACAGACTTGGGCAGG + Intronic
916061665 1:161102962-161102984 AAAAAAAAAAAGAATGGGGTTGG + Intronic
916124934 1:161560886-161560908 ATAAAGACACAAAATGGGATGGG + Intergenic
916134825 1:161642231-161642253 ATAAAGACACAAAATGGGATGGG + Intronic
916869892 1:168902352-168902374 TTATATAAACAGATTGGGGTTGG + Intergenic
917023152 1:170612490-170612512 ATTAAGACACAGACTGGGCCGGG - Intergenic
917029044 1:170669564-170669586 ATAAAAAATCAGACTGGTCTAGG - Intronic
917118625 1:171626370-171626392 AAAAGGAAACAGACTGGGCATGG - Intergenic
917157797 1:172023749-172023771 AAACAGAAACAGTTTGGGGTTGG - Intronic
917551198 1:176031677-176031699 ATAAAGAAACATACTCTAGTTGG + Intronic
917680255 1:177358753-177358775 AGAAAGAAAGAGAGTGGGGGAGG + Intergenic
918515708 1:185360311-185360333 AGAAAGAACCAAACTGGGCTGGG + Intergenic
918855738 1:189754787-189754809 AAAAAAAAACATACTGGGGGAGG + Intergenic
919722824 1:200857853-200857875 ATCAATAAACTGACTGGGATAGG + Exonic
920186933 1:204165587-204165609 AAAAAAAAAAAGACGGGGGTCGG - Intronic
920286821 1:204885594-204885616 ATGAAGAAAGTGACTGGGCTGGG + Intronic
921058850 1:211565520-211565542 AAAAAAAAACAGGCTGGGGGTGG + Intergenic
922442058 1:225664093-225664115 AAAAACAAACAGACTGGGCATGG + Intergenic
922509960 1:226157155-226157177 AAAAGGAAAGAGACTGGGGAAGG - Intronic
922592416 1:226787340-226787362 TGAAAGACACAGACTCGGGTAGG - Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923624910 1:235606131-235606153 ATAAACAAGCAGACCGAGGTGGG + Intronic
923871186 1:237995745-237995767 ATGACAAAACAGACTGAGGTGGG - Intergenic
923920762 1:238562024-238562046 ATAAAGAAATAGCCTGGAGTGGG - Intergenic
924225917 1:241921529-241921551 ATAAAGAAACAGCATGGGCCAGG + Intergenic
924303882 1:242667011-242667033 ATAAATAAATACAATGGGGTGGG - Intergenic
924397454 1:243637869-243637891 AAAAAGAATCAGACTGGCATTGG + Intronic
924560697 1:245154937-245154959 ATAAAGATCCAGACTCGGGGAGG - Intergenic
924596957 1:245454763-245454785 AGAAAGAAAAAAAATGGGGTAGG - Intronic
924825891 1:247538641-247538663 GGAAAGAAAGAGACTGGGGTAGG - Intronic
1062966580 10:1611936-1611958 AGAAAGAAACAGACAAGGGCAGG - Intronic
1063903537 10:10760272-10760294 ATAAAGAGGGGGACTGGGGTAGG - Intergenic
1064768990 10:18704197-18704219 GTAAAGAAAAAGACATGGGTGGG - Intergenic
1065707952 10:28488444-28488466 AAAAAGAAAAAGACTGGGGCTGG + Intergenic
1065727988 10:28684621-28684643 ATCAAGAGCCAGAGTGGGGTTGG - Intergenic
1065791128 10:29261958-29261980 ATAAATAAACAGGCTGGGCATGG - Intergenic
1065832391 10:29626732-29626754 ATAAAGAATCAGGCTGGGCGCGG + Intronic
1065904756 10:30240447-30240469 AAAAAGAAAAAGACTGGGCGTGG + Intergenic
1065931908 10:30487389-30487411 ATAAAGAAATAGGCTGGGTGTGG - Intergenic
1068672794 10:59741086-59741108 ATAAAGAAATAGGCTGGGACTGG - Intergenic
1069032979 10:63617694-63617716 ATAAAAAATAAAACTGGGGTGGG - Intronic
1069032986 10:63617735-63617757 ATAAAAAATAAAACTGGGGTGGG - Intronic
1069302415 10:66925213-66925235 ATGAGGAAACAGACTTGGGGAGG - Intronic
1069376805 10:67801121-67801143 ATAAAGAATTAGAATGTGGTGGG + Intronic
1069564670 10:69455626-69455648 AGAAAGAAAGAGACGGGGGGGGG - Intronic
1069883959 10:71611568-71611590 TTAAAGTGACAGCCTGGGGTGGG + Intronic
1070610733 10:77930637-77930659 ATAAATAAATAGGCTGGGCTTGG - Intergenic
1072100485 10:92224957-92224979 AAAAAGAAAGAAAATGGGGTAGG - Intronic
1072490098 10:95896769-95896791 ACCAAGGAACAGAGTGGGGTCGG - Intronic
1072504650 10:96052980-96053002 GTAAAGTTACAGACTAGGGTTGG - Intronic
1072558994 10:96552292-96552314 ATAAAAAAATAGCCAGGGGTGGG + Intronic
1072692321 10:97580185-97580207 ACAAAAAAACAGACCAGGGTTGG + Intronic
1073102880 10:101016006-101016028 ATTAAGAAACAGACTGGTATAGG - Intronic
1073276720 10:102318185-102318207 ATAAATAAATAGACTGGGCATGG - Intronic
1074072392 10:110085807-110085829 ATTAAGAAACAGACTTGGGCCGG + Intronic
1074429889 10:113385524-113385546 GCAAACAAACAGACTGGCGTGGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074620123 10:115110137-115110159 ATATAGAAATAAACTGAGGTAGG + Intronic
1075762971 10:124870635-124870657 AAAAAGAAAGAGACTGGGCATGG + Intergenic
1075968588 10:126633555-126633577 ATAAAGAAAAAGCCAGGCGTGGG + Intronic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1077635658 11:3840302-3840324 ATACAGACAACGACTGGGGTCGG + Intronic
1078015257 11:7607959-7607981 ATAAAGAAAGAGAGGGAGGTAGG + Intronic
1078230975 11:9442707-9442729 AAAAATAAACAAACTGGGGCTGG - Intronic
1079400414 11:20102378-20102400 GTGAAGACACAGACTGGGGCAGG + Intronic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079440139 11:20505238-20505260 AAAAGGATACAGACTGGGGGAGG - Intronic
1080032580 11:27677537-27677559 AAAAAAAAACAGGGTGGGGTGGG + Intronic
1080286366 11:30618754-30618776 AAAATGAAAAAAACTGGGGTAGG - Intergenic
1080552745 11:33387803-33387825 GTAAAGACACAGACGGGGGATGG - Intergenic
1081561964 11:44226082-44226104 GCAAAGAGACAGACTGGGGTTGG - Intronic
1081616890 11:44596479-44596501 ATAGAGAAAGGGAGTGGGGTTGG + Intronic
1081924520 11:46813680-46813702 ATAAAGAACCACACAGGGATGGG + Intronic
1081932370 11:46880697-46880719 ACAAAGAAAAAAAGTGGGGTGGG + Intronic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1082180153 11:49107052-49107074 AAAAAGAGAAAGAGTGGGGTGGG + Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083015748 11:59452108-59452130 AAAAAGAAACAGACTGGGTGTGG - Intergenic
1083400978 11:62423463-62423485 AGATAGGAACAGACTGGGGCAGG - Intergenic
1083865876 11:65452567-65452589 AAAAAGAAAAAGGCTGGGGAGGG - Intergenic
1084383362 11:68827530-68827552 ATAAACAAACAAACTGGTGGGGG - Intronic
1084952563 11:72674749-72674771 AAATAGAAAGAGAGTGGGGTAGG + Intergenic
1085023858 11:73225298-73225320 AGAAAGGCCCAGACTGGGGTAGG + Intronic
1085149874 11:74242582-74242604 CTAAGAAAACAGTCTGGGGTTGG + Intronic
1085187593 11:74589556-74589578 ATAAATAAACAGGCTGGGCACGG + Intronic
1085192990 11:74645200-74645222 AGAAAGAAACAGGCTGAGGTAGG + Intronic
1085544394 11:77303491-77303513 ATAAACATACAGAATGGTGTAGG - Intergenic
1085778482 11:79387712-79387734 ATAAACAAACAGGCTGGGTGTGG + Intronic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1085920182 11:80945042-80945064 ATCAAGCAACAGACTGGGCCAGG - Intergenic
1088291845 11:108247452-108247474 AAAAAGAAACAGACTGGGCTTGG - Intronic
1088416241 11:109592132-109592154 ACAAAGAAACGGGCTGGTGTTGG + Intergenic
1088428714 11:109732988-109733010 ATAAAGAAACAAATCGGGGCTGG - Intergenic
1088632276 11:111785208-111785230 ATAAGGAAACAGGCTGCGGGTGG - Intronic
1089157353 11:116412743-116412765 GCAAAGAAAGAGACTGGGGAGGG - Intergenic
1089206779 11:116770788-116770810 AAAAAGAAAAAGACTAGGGCCGG - Intronic
1089660949 11:119984913-119984935 GAAAAGAAACAGACAAGGGTGGG - Intergenic
1091085409 11:132717227-132717249 ATAAAGAAATAATCTGAGGTGGG + Intronic
1091460610 12:641542-641564 CTAAAGAAACAGGCTAGGGCCGG + Intronic
1091493490 12:952599-952621 ATAAGAAAACAGGCTGGGTTCGG + Intronic
1093250248 12:16793966-16793988 ATAAAGACACAGAATAGGTTAGG + Intergenic
1093314382 12:17629937-17629959 TTAAACAAATAGACTGGTGTAGG - Intergenic
1095546897 12:43382826-43382848 ATAAAAAAACAGACTGGATGGGG + Intronic
1096100418 12:48967593-48967615 ATATAAAAACAGACTGGGCCGGG - Intronic
1096702939 12:53398569-53398591 AAAAATAAAAAGACTGGGTTTGG - Intronic
1097227179 12:57484635-57484657 ATAAACAAACAAACTGAGGTAGG - Intronic
1097353028 12:58569974-58569996 ATCAAGAAACAGACTTGGCCAGG + Intronic
1097682378 12:62660864-62660886 TTAAAGGAACACACAGGGGTAGG + Intronic
1099225700 12:79966635-79966657 ATCAAGAAACAGAATGGCTTTGG - Intergenic
1100405504 12:94269384-94269406 AGAAAGAGACAGACTGGGGTAGG - Intronic
1100552998 12:95664346-95664368 ATAAATAAATAGACTGGGCATGG - Intronic
1100917794 12:99446116-99446138 AAAAAAAAACAGGGTGGGGTGGG + Intronic
1101729520 12:107415411-107415433 ATAAAAACACAAACTGGGCTGGG + Intronic
1101824396 12:108209436-108209458 AGCAAGAAAGAGAGTGGGGTAGG + Intronic
1101934505 12:109046406-109046428 AAAAAAAAAAAGACTGGGCTGGG - Intronic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1104670627 12:130677683-130677705 ATACAAAACCAGTCTGGGGTGGG + Intronic
1105223575 13:18357276-18357298 ATAAAGAAAAAGACTGTTATCGG - Intergenic
1105340764 13:19523152-19523174 AGAAAGGAACAAAATGGGGTTGG - Intronic
1105695412 13:22883779-22883801 AGAAAGAAACAGAACAGGGTAGG - Intergenic
1105756978 13:23474934-23474956 ATAAAGAAACAGAATAGATTAGG - Intergenic
1106031848 13:26011641-26011663 AGAAATAAACAGACTGGGCATGG + Intronic
1106530398 13:30585390-30585412 ATAAAGAAAAGTACAGGGGTGGG + Intronic
1106726637 13:32493213-32493235 AAAAAGAAAGAGACTGGGCACGG - Intronic
1107130436 13:36888462-36888484 ATAAAGAAACAGCCTGAGACTGG - Intronic
1107719600 13:43234055-43234077 ATCTAGATACAGACTGTGGTAGG - Intronic
1108903519 13:55442743-55442765 AATGAGAAACAGATTGGGGTGGG + Intergenic
1109085791 13:57969906-57969928 AGAAAGAAACAGAAAGAGGTGGG + Intergenic
1109799512 13:67358009-67358031 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112565207 13:100546518-100546540 ATAAGGAAATAGACTGGGTGCGG + Intronic
1112858747 13:103804142-103804164 TTAAAGAAATAGACTATGGTGGG + Intergenic
1113453177 13:110427443-110427465 ATAAAGAAACAAACTTGGCTGGG - Intronic
1113811931 13:113148037-113148059 ATAAAAAAACAGGCTGGGTGTGG + Intronic
1114701523 14:24683259-24683281 ATAAAGAGACAGACTGAGCCTGG - Intergenic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1117056358 14:51916051-51916073 ATAAAGAAACAAACAGGAATAGG - Intronic
1117130560 14:52682601-52682623 AGAAAGACACAGACTGGGCCGGG + Intronic
1117130613 14:52682910-52682932 AAAAAGACACAGATTGGGCTGGG + Intronic
1117316936 14:54580337-54580359 GTAAAGAAACAGAAAGGGGTGGG - Intronic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1117478742 14:56121731-56121753 ATAAAGAAACAGAGAGGAGGAGG - Intronic
1117828132 14:59724731-59724753 AAAAAAAAACAGCCTGGGGAAGG + Intronic
1118462355 14:65998759-65998781 ACAAACAAACAGCCTGGGTTTGG + Intronic
1118725616 14:68627004-68627026 GTAAGAAAACAGGCTGGGGTGGG - Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119358358 14:74026150-74026172 AAAAAGAGAGAGACTGGGGGCGG + Intronic
1119367498 14:74106565-74106587 ATAATAAATCAGGCTGGGGTAGG - Intronic
1119574385 14:75705557-75705579 AAAAAGAATCAGAGTGGGTTAGG - Intronic
1120859083 14:89238294-89238316 GTCAAGAAACAGAGTGGGATTGG - Intronic
1122015756 14:98794913-98794935 ATAAAAAAACAAACTTGGCTGGG + Intergenic
1122901859 14:104785318-104785340 GTAAACAACCAGGCTGGGGTGGG + Intronic
1123465694 15:20513370-20513392 ATATAGAAACAGAATAGGGCCGG - Intergenic
1123652422 15:22487668-22487690 ATATAGAAACAGAATAGGGCCGG + Intergenic
1123742844 15:23296529-23296551 ATATAGAAACAGAATAGGGCCGG + Intergenic
1124276418 15:28329347-28329369 ATATAGAAACAGAATAGGGCCGG - Intergenic
1124306284 15:28582260-28582282 ATATAGAAACAGAATAGGGCCGG + Intergenic
1125007242 15:34831446-34831468 ACAAAGAAACAGTCTGGGATGGG + Intergenic
1125968645 15:43894345-43894367 AGAAAGAAAGAGACTGGGAGTGG + Intronic
1126287350 15:47028177-47028199 AGAAAGAATCAAACTGGGCTGGG + Intergenic
1127277782 15:57462295-57462317 CAAAAGGAACAGACTAGGGTGGG - Intronic
1127479604 15:59366272-59366294 AAAAAGAAAGAGACAGGGCTGGG - Intronic
1127735459 15:61835034-61835056 AGGAGGAAACAGAATGGGGTAGG + Intergenic
1127854317 15:62942162-62942184 ATAAGGAAACAGACCTGGGAAGG + Intergenic
1127997309 15:64160938-64160960 ATAAAAAAACAGGCTGGGCATGG - Intronic
1128018182 15:64366680-64366702 ATAAAAAATCAGGCCGGGGTCGG + Intronic
1128337098 15:66793941-66793963 AAAAAAAAAAAGATTGGGGTGGG + Intergenic
1129918857 15:79300867-79300889 AGAATGAAACAGAATGGGATGGG - Intergenic
1130006033 15:80099268-80099290 ATAAAGAAAAAGTCGGGGGGAGG - Intronic
1130139933 15:81216465-81216487 AAAAAGAAAAAGCCAGGGGTGGG - Intronic
1130167889 15:81481884-81481906 ATAACTGAACACACTGGGGTAGG + Intergenic
1130617054 15:85420392-85420414 ATGAATGAACAGACTGGGCTAGG - Intronic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131142665 15:89990243-89990265 ATAAAAAAAAGGACTGGGCTGGG - Intergenic
1133799561 16:9074077-9074099 ATAAACAAATAAACTGGGCTGGG - Intergenic
1134017098 16:10896375-10896397 AAAAAGAAAGTGTCTGGGGTTGG + Intronic
1134614108 16:15636573-15636595 GAATTGAAACAGACTGGGGTGGG + Intronic
1135249311 16:20887498-20887520 TTAAAGAAACAGACTGAGAGGGG + Intronic
1135393287 16:22111771-22111793 ATAAACAAACTGACTGGGTGTGG - Intronic
1135399684 16:22157709-22157731 AAAATAAAAAAGACTGGGGTTGG + Intergenic
1136251554 16:29008847-29008869 AGAAAGAAAAAGACAGGGATGGG + Intergenic
1136387029 16:29934673-29934695 AAAAAGAAAAAGGCTGAGGTGGG - Intergenic
1137067575 16:35864240-35864262 TTGCAGGAACAGACTGGGGTAGG - Intergenic
1137264299 16:46856190-46856212 ATAAAGGGGCAGACTGGGCTTGG + Intergenic
1137585343 16:49660922-49660944 TTAAAGATACAGACTGGGGCTGG + Intronic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1137926868 16:52547946-52547968 ATAAAGAAATAAAGAGGGGTGGG - Intergenic
1138006764 16:53344375-53344397 ATAAATAAAAAGACAGGAGTAGG - Intergenic
1138206966 16:55132510-55132532 GTAAAGAACAAGGCTGGGGTAGG - Intergenic
1138298589 16:55908104-55908126 ATAAAGAATCAGACAGGGCAGGG - Intronic
1138826742 16:60329928-60329950 ATAAATAAACAGTCTGGGCGTGG - Intergenic
1139334796 16:66224224-66224246 ATAAAGAACCACACTGGACTGGG - Intergenic
1139453293 16:67049496-67049518 AAAAATAAACAGAATGGGGCCGG - Intronic
1139673773 16:68509297-68509319 AAAAAAAAACAGACTGGGCGTGG - Intergenic
1139762175 16:69193773-69193795 ATAAAGAACCAGACAGGTCTCGG + Intronic
1139897212 16:70297202-70297224 ATAAATAAATAGACTGGGCACGG - Intronic
1140518555 16:75562624-75562646 ATAAAAACAAAGGCTGGGGTTGG - Intergenic
1141181364 16:81755162-81755184 ATAAAGGAACAGGCTTGGGGTGG - Intronic
1141289447 16:82704144-82704166 ATAAAGAAAGAGGTGGGGGTGGG + Intronic
1142640398 17:1281899-1281921 ATATAGAAACTCACTGGGGCAGG - Intronic
1142857465 17:2739388-2739410 ATAAACAAACAGGCTGGGCGCGG + Intergenic
1143000479 17:3791728-3791750 ATAATGAATCAGAATGGGGCTGG + Intronic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1143254728 17:5547469-5547491 ATAAAGAAATGGGCTGGGGAAGG - Intronic
1144059596 17:11570809-11570831 TTAAAGAAAAAGACTGCAGTTGG - Intergenic
1145286556 17:21510526-21510548 ATAACAAAAAAAACTGGGGTGGG - Intergenic
1146401258 17:32501726-32501748 ATAAAGAGACAGACAGGGCAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146627330 17:34444598-34444620 ATAAAGAGACAGACTTGGAGAGG + Intergenic
1147204535 17:38827232-38827254 AGAAAGAAACAGGCTGGGCTCGG + Intergenic
1147253635 17:39168362-39168384 ATAAAGACCCAGACTGGGAATGG - Intergenic
1147265878 17:39234337-39234359 CTAAAGAAACAGACCTGGCTGGG + Intergenic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147544360 17:41389054-41389076 ATAAAGAAATAAACTGGGAAAGG + Intronic
1147616742 17:41833607-41833629 ATAAAGAAACAGGCCGGGTGTGG - Intronic
1147855859 17:43479302-43479324 AAAAAGAAAAACACTGGGCTGGG - Intergenic
1148338203 17:46855687-46855709 ATAAATAAATAGACTGGATTGGG - Intronic
1149160756 17:53689800-53689822 CTATAGAAACAGACTATGGTAGG - Intergenic
1149782618 17:59409920-59409942 GTAAAGAAAGAGTCTGGGCTGGG - Intergenic
1149809841 17:59657900-59657922 ATAAAAAAAAAGACAGGGGCTGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150417801 17:65001596-65001618 GGGAAGAAACAGACTTGGGTGGG - Intergenic
1150843771 17:68634281-68634303 ATAAAGAAAAAGAGGTGGGTGGG - Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151068989 17:71186657-71186679 TTAAAAAAACAGAGTGGGGAAGG + Intergenic
1151086965 17:71391237-71391259 ATAAAATAACAGACGGGGGTGGG + Intergenic
1151594667 17:75070269-75070291 AAAAAAAAAAAGACTGGGGCCGG + Intergenic
1151668907 17:75560779-75560801 ATAAATAAACAAACTGGGCCAGG - Intronic
1152175749 17:78786073-78786095 AAAAAAAAAAAGACTGGGCTAGG + Intergenic
1152447126 17:80352146-80352168 ATAAATACACTGACTGGGCTGGG - Intronic
1152969770 18:150256-150278 ATAAAGAAATTGAAGGGGGTGGG - Intergenic
1153020101 18:621172-621194 ATTAAAAATCTGACTGGGGTGGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153853954 18:9126373-9126395 ATAAACAAACAAACTTGGGGAGG + Intronic
1154082398 18:11270869-11270891 CTAAAGAATCAGACTTGAGTGGG + Intergenic
1154154605 18:11934121-11934143 AGAAAGAAACAGGCTGGGTGCGG - Intergenic
1154962939 18:21328079-21328101 ATAAAGAAACAGGCAGAAGTAGG - Intronic
1155795264 18:30027445-30027467 AAAAAAAAACAGGCTGGGGGAGG - Intergenic
1155958451 18:31973873-31973895 TTAAACAAACAGGCTGGGCTTGG + Intergenic
1156954397 18:42943963-42943985 ATAAAGTAAGGGAATGGGGTGGG - Intronic
1158662241 18:59398671-59398693 CAAAAGAAATAGCCTGGGGTTGG + Intergenic
1160706027 19:530834-530856 AAAAAAAAAAAGACTCGGGTAGG + Intergenic
1161078787 19:2300326-2300348 CTAAAGAATCAGCCTGGGGCCGG - Intronic
1161423935 19:4191770-4191792 ATAAATAAATAGGCTGGGGACGG - Intronic
1161737585 19:6001156-6001178 AGAAAGAAACAGGCTGGGGATGG - Intronic
1162507359 19:11094119-11094141 ATAAACAAACAAACTGAGGTGGG - Intronic
1162649212 19:12073151-12073173 AAAAAAAAGCAGACTGTGGTAGG - Intronic
1163095487 19:15054240-15054262 ATAAAAACACAGACTTGGTTGGG - Intronic
1163165343 19:15493794-15493816 AGAAAGAAACAGTCTCGGCTGGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163411566 19:17158160-17158182 AAAAAACAAAAGACTGGGGTAGG - Intronic
1163716454 19:18875253-18875275 AGAAAGAAACAGGCTGGGCGCGG + Intronic
1163750185 19:19072248-19072270 ATAAGGAATCAGACAGGGCTGGG - Intronic
1164369991 19:27635863-27635885 ATAATTAAACTGCCTGGGGTCGG + Intergenic
1165172404 19:33903346-33903368 ATAAAAAAAAAGATTAGGGTGGG - Intergenic
1165207255 19:34200561-34200583 ATGGAGAAACAGAGTGGGTTTGG + Intronic
1165711008 19:38010977-38010999 ATAAAGAAACAAACTGTGTAAGG - Intronic
1166398223 19:42458054-42458076 GTAAAGAGAAAGACTGGGCTGGG + Intergenic
1166644894 19:44524574-44524596 ATAAAGAAAAAGAGTGGGTAGGG - Intronic
1167303611 19:48694594-48694616 AAAAAGAAACAGGGTGGGGCGGG - Intergenic
1167333728 19:48872134-48872156 ATAAATAAATAAATTGGGGTGGG + Intergenic
1168016294 19:53575970-53575992 ACAAAAAAACAGACTGGGCACGG - Intronic
1168041726 19:53764310-53764332 ATAAAAGAACTCACTGGGGTTGG - Intergenic
1168091408 19:54087726-54087748 AAAAAAAAACAGAGTGGGGTGGG - Intergenic
1168310494 19:55457536-55457558 AAAAAAAAAGAGACTGGGCTTGG + Intronic
1168356256 19:55701948-55701970 AAAAAAAAAAAGAATGGGGTGGG - Intronic
1168565121 19:57416117-57416139 AGAAAGAAACAGGATTGGGTTGG + Intronic
925878651 2:8332664-8332686 ATAAACAAAAGGAGTGGGGTGGG + Intergenic
925920675 2:8635749-8635771 TTAAAAAAACAGGTTGGGGTTGG - Intergenic
927593009 2:24373049-24373071 TTAAAGAAACAGAATGGGCCGGG + Intergenic
927898936 2:26805022-26805044 AAAAACAAACAGGCTGGGCTTGG - Intergenic
928092290 2:28382344-28382366 ATAAATAAACAGACGGTGGGTGG + Intergenic
928890604 2:36199183-36199205 ATGAAGAAACACACTGGAGCAGG - Intergenic
928943334 2:36750301-36750323 ACAAAGACACAGACTGGAGAGGG - Intronic
928993492 2:37261194-37261216 ATAAAGATACAGGCTGGGTGTGG + Intronic
929002166 2:37358120-37358142 AAAAAGAAACAGCCTGGGCATGG + Intronic
929747080 2:44670282-44670304 ATTAAAACACAGACTGGGCTGGG + Intronic
930258320 2:49116903-49116925 AAACAGAAATAGAATGGGGTAGG - Intronic
931334505 2:61326066-61326088 AACAAGAGACAGACTGTGGTCGG + Intronic
931540754 2:63326521-63326543 AGAAAGAGACAGAGAGGGGTAGG + Intronic
931554646 2:63489032-63489054 ATGAAGCAACAGCCTGGTGTAGG + Intronic
931991819 2:67797782-67797804 ATAGAGAAACATGCTGGGTTTGG + Intergenic
932310471 2:70735682-70735704 ATAGAGATAGAGACTGGGCTTGG - Intronic
932628652 2:73319417-73319439 AAACAGGAACAGACTGGGATTGG + Intergenic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
933800189 2:85954351-85954373 ATAAAGAAACAGGCTTGGAGAGG + Intergenic
934962707 2:98691095-98691117 ATAGAGAAAGAGGGTGGGGTGGG + Intronic
936271268 2:111050943-111050965 AGAAACTAACAGATTGGGGTTGG + Intronic
936876561 2:117196791-117196813 ATAATGAATAAGACTGGGATGGG - Intergenic
937368509 2:121282226-121282248 ATAAGAAAATAGACTGGGCTGGG - Intronic
937727144 2:125180688-125180710 ATTAAGAAACAGACTCTGTTGGG - Intergenic
939057811 2:137384496-137384518 AATAGGAAAGAGACTGGGGTAGG + Intronic
939277471 2:140017626-140017648 ATAGAGAAACAAAATGTGGTAGG + Intergenic
940745698 2:157565135-157565157 ATAAAAAAAAAGAGTGGGGGAGG + Intronic
941189847 2:162367894-162367916 TTCAAGAAAAAGACTGGGGGAGG + Intronic
941376619 2:164739265-164739287 ATTAGGAAACACAGTGGGGTTGG - Intronic
941648954 2:168072457-168072479 AGAAAGAAACAGAATGGGATGGG - Intronic
942076596 2:172361935-172361957 AAAAGGAAAAAGAATGGGGTGGG + Intergenic
942242940 2:173980339-173980361 AGAAAGAACCAGAAAGGGGTGGG + Intergenic
943635225 2:190299546-190299568 GTAAACAAACATACTGGGGAAGG + Intronic
943662602 2:190575148-190575170 AAAAAGAAACAGAGTCGGCTGGG - Intergenic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
945640706 2:212424947-212424969 ATAAAGAAAAATAATGGTGTAGG + Intronic
945811686 2:214557019-214557041 ATAAGGAAACAGTGCGGGGTTGG + Intronic
946341459 2:219071866-219071888 ATAGAGAAACTGAGTGGGGTGGG + Intergenic
946907171 2:224428634-224428656 ATAAAGAGAGAGAATGGGGCGGG - Intergenic
947616981 2:231564308-231564330 ATAAAGAAACATTCTTGGATGGG - Intergenic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948122375 2:235540447-235540469 ATAAAGAAATGGATTGAGGTTGG - Intronic
948401521 2:237689055-237689077 AAAAAAAAAAAGACTGGGGGTGG + Intronic
948706294 2:239795407-239795429 AGAAAAAAAGAAACTGGGGTTGG - Intronic
948749299 2:240121619-240121641 GTGAAGGAACAGACTGTGGTGGG - Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1169303482 20:4467548-4467570 AAAAAGAAACAAACAGAGGTGGG + Intergenic
1169362902 20:4966130-4966152 ATATACATATAGACTGGGGTAGG + Intronic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1169584964 20:7071194-7071216 AGAAAGAAACAGACTAGGAAGGG + Intergenic
1170090216 20:12582492-12582514 ATCAAGAAACAGCCTCGGGGAGG + Intergenic
1170913239 20:20596069-20596091 ATAAAGAAACACAGTTGGGGAGG - Intronic
1171363271 20:24605433-24605455 ACAGAGATACAGACTGGGGGAGG - Intronic
1172052752 20:32131665-32131687 ATACAGAAACTGACTTGAGTTGG + Intronic
1172586335 20:36087806-36087828 ATAAAAGAATAGACTGGGGCTGG - Intergenic
1172804827 20:37604286-37604308 ATATCCAAACAGTCTGGGGTTGG - Intergenic
1173136585 20:40444081-40444103 AGAAAGACCCAGAATGGGGTGGG - Intergenic
1173172155 20:40736154-40736176 ATATAGATACAGGTTGGGGTTGG + Intergenic
1173529139 20:43755191-43755213 ATAAAGGAATAAACTGAGGTTGG + Intergenic
1173580355 20:44142651-44142673 ATAAAGACAGAGCCTGTGGTCGG - Intronic
1174024687 20:47563911-47563933 AAAAAGAAAAAGGCTGAGGTGGG + Intronic
1174449887 20:50613155-50613177 ATAAAGAAACAGGATGGGTGTGG + Intronic
1175325163 20:58120792-58120814 ATAAAAAAACAGGCTGGGCATGG + Intergenic
1175726606 20:61322774-61322796 GGAAAGTGACAGACTGGGGTGGG + Intronic
1176368617 21:6049199-6049221 ATAAAGAAACAAACTGAGACTGG - Intergenic
1176732117 21:10509656-10509678 ATAAAGAAAAAGACTGTTATCGG - Intergenic
1177136272 21:17308282-17308304 ACAAAAAAAAAAACTGGGGTTGG + Intergenic
1177714852 21:24826362-24826384 ATAAAGAAACAGCTGAGGGTTGG + Intergenic
1177743437 21:25181557-25181579 ATAAAGAATCAGGCTGGGCGCGG + Intergenic
1177897324 21:26869359-26869381 AGAAACAAACAGGCTGAGGTAGG + Intergenic
1178621385 21:34179910-34179932 AAAATGAAACACAATGGGGTCGG - Intergenic
1178975598 21:37218552-37218574 GTAAAGAGACTGGCTGGGGTTGG + Intergenic
1179377021 21:40859002-40859024 CTCAAAAAACAGACTGGGGTAGG + Intergenic
1179754902 21:43489343-43489365 ATAAAGAAACAAACTGAGACTGG + Intergenic
1179841759 21:44080827-44080849 ATGAAGAAAAAGACTGGGTGCGG - Intronic
1180204676 21:46251308-46251330 GTAAAGAAGCAGGCTGGGCTTGG + Intronic
1180617743 22:17139534-17139556 AAAAACAAACAAACTGGGGACGG + Intronic
1181693147 22:24577280-24577302 ATGAAGAATAAGACTGGGGGTGG + Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182171127 22:28230632-28230654 ATACAGAGAGAGACTGGGGGAGG + Intronic
1182886981 22:33782569-33782591 ATAAAGAATCAAATTGGGCTGGG + Intronic
1183011886 22:34953298-34953320 ATAAAGAGAGGGACTGAGGTGGG - Intergenic
1183775402 22:39960902-39960924 CTAAGGTAACAGACTGAGGTAGG + Intronic
1184012120 22:41757076-41757098 AGAAAGAAACAAACTGTGGAGGG - Intronic
1184020467 22:41817762-41817784 ATAAATAAAAAGAGAGGGGTAGG + Intronic
1184144410 22:42600671-42600693 AGTAAAAAACAGACTGGGGCTGG + Intronic
949167466 3:959517-959539 ATATATAAACAGAATGGGGATGG + Intergenic
949322602 3:2827713-2827735 ATAAAGAATCACACAGGGTTTGG - Intronic
949771703 3:7586455-7586477 ATGGATAAACAAACTGGGGTGGG + Intronic
950280440 3:11703179-11703201 ATGAGGAAACAGAATGGGCTTGG + Intronic
950754068 3:15157737-15157759 TTGAAGGACCAGACTGGGGTGGG - Intergenic
950885398 3:16358054-16358076 AAAAAGAAAAAGGCGGGGGTGGG + Intronic
950932964 3:16809321-16809343 AAAAAGAAAAAGTCTGGGGGTGG - Intronic
951125118 3:18975539-18975561 ATAGAAAGAGAGACTGGGGTAGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951706861 3:25552383-25552405 ATAATGAAAATGGCTGGGGTTGG + Intronic
951828424 3:26895773-26895795 TTAAAAAAACAGACCTGGGTTGG - Intergenic
952417674 3:33104299-33104321 ATAAAGAAATAGGCTGGGTGCGG - Intergenic
952860735 3:37810406-37810428 AAAAAGAAACAGACTAGGTGAGG - Intronic
953536715 3:43782529-43782551 ATGATGGAACAGTCTGGGGTTGG + Intergenic
953977923 3:47396276-47396298 ATAAAGAAACTGCCTAGGCTGGG + Intronic
954331666 3:49894270-49894292 ATAATAAAACAGGCTGGGTTCGG + Intronic
954412438 3:50376684-50376706 AGTAAGAAACTGACTGGGGGAGG - Intronic
954479095 3:50781222-50781244 AAAAAGAATCCCACTGGGGTGGG + Intronic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955752175 3:62194520-62194542 GTAAAGAAACAGACCTGGGCAGG + Intronic
956231673 3:67023445-67023467 ATAAGGAAAGAGACAGAGGTGGG + Intergenic
956291769 3:67668108-67668130 ATAAAGCAAGAGGCTGGGCTTGG - Intergenic
956374138 3:68596045-68596067 AGAAAGAAACAGAGTGGGGTGGG + Intergenic
956498685 3:69857353-69857375 TTAAAGAAAGAAACTGGGGGGGG - Intronic
957502745 3:81077987-81078009 AAAAAAAAAAAGGCTGGGGTGGG + Intergenic
957666085 3:83230118-83230140 ATAAAGACCCAGAGTGGAGTTGG - Intergenic
957690071 3:83555752-83555774 TTAAAGAAGCAGTCTGGGCTGGG + Intergenic
957715784 3:83928378-83928400 AAAAAGAAACAGCCTGGGTTGGG - Intergenic
957947180 3:87079864-87079886 TTAAAGGAACAGAATGGGGCTGG + Intergenic
960273978 3:115705989-115706011 ATAAGGAATCAGAATGGGGTAGG - Intronic
960456965 3:117884196-117884218 AGAAGGAAACAGAGTGGGGAAGG + Intergenic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
960854274 3:122086744-122086766 TCAGAGAGACAGACTGGGGTGGG - Intronic
961197560 3:125015498-125015520 GCAAAGAAACAGCCTGAGGTGGG + Intronic
961258133 3:125575520-125575542 ATAAAAAAACAAACAGTGGTAGG - Intronic
963356343 3:144212907-144212929 ATACAGAAAGAGACTGAGTTGGG - Intergenic
963519466 3:146346224-146346246 ATAAAATAACAGAAAGGGGTGGG - Intergenic
963815484 3:149825949-149825971 ATAAAGATACAAAGAGGGGTAGG - Intronic
964200636 3:154115004-154115026 ATAAAGAACCAGCCTGACGTTGG + Intergenic
965666823 3:171103157-171103179 ATACAGAAACACACTTGGCTAGG + Intronic
966003512 3:174979598-174979620 AGAAAGAAACAAAATGGGCTGGG - Intronic
966732747 3:183163909-183163931 ATAAAAAAACACACTGGGAGTGG - Intergenic
967017671 3:185496598-185496620 GGAGAGAAACAGGCTGGGGTGGG + Intronic
967043922 3:185719064-185719086 AGGAAGAAACAGACTGTGTTTGG + Intronic
967065482 3:185911577-185911599 AGAAAGAAACAGATTGTGGCCGG + Intergenic
968080485 3:195843111-195843133 TTAAAAAAACAGACTGGGCATGG + Intergenic
969272929 4:6115116-6115138 ATAAAAAAACAGGCTGGGTGTGG + Intronic
970841084 4:20470555-20470577 CAAAAAAAACAAACTGGGGTTGG - Intronic
970996367 4:22271785-22271807 ATTAAGAAACAAAGTGGGGAGGG + Intergenic
971147689 4:23996584-23996606 CAAGAGAAACAGAGTGGGGTTGG - Intergenic
972499110 4:39661309-39661331 AAAAAAAAACAGACTGGGTGTGG - Intergenic
972505539 4:39717008-39717030 AAAAAAAAAAAGCCTGGGGTGGG + Intronic
973937542 4:55863188-55863210 ATAAAAAAACAGGCTGGGCTTGG - Intronic
974425938 4:61743707-61743729 ATTAAGAAAAAGACAGGGGCTGG + Intronic
974709969 4:65578215-65578237 AAAAAGAAAAAGACTAGGGATGG - Intronic
975649560 4:76579176-76579198 ATAAATAAACAGGCTGGGCGTGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976638089 4:87308357-87308379 ATAAATAAATAGGCTGGGCTTGG + Intronic
976640588 4:87333720-87333742 ATAAAGAAAAAGATTAGGCTGGG + Intergenic
977006381 4:91572664-91572686 TTAAAGAAGCAGTCTGGGCTGGG + Intronic
978455216 4:108881483-108881505 ATAAAGAAACACACAGGTCTAGG + Intronic
978826815 4:113034443-113034465 ATAAAGAAACCTCCTGGGGGTGG + Intronic
980143343 4:128948783-128948805 CTAATTAAACAGACTGAGGTTGG + Intronic
982019074 4:151185644-151185666 ATAAAGAAAAAAAATGGAGTGGG + Intronic
982859772 4:160434448-160434470 TTAAATAAGCAGACTGGGCTTGG + Intergenic
983979970 4:173983587-173983609 ATAAAGAAAGAGGCTGGGTGTGG + Intergenic
984415055 4:179447168-179447190 ATAAAGAAAGAGAATTGGCTAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986158796 5:5204431-5204453 ATCAAGATACAGAGTGTGGTAGG + Intronic
986644784 5:9906267-9906289 ATAAAGAAACAGAATTATGTTGG - Intergenic
988011884 5:25499131-25499153 ATGAAGAATGAGACTGGTGTGGG + Intergenic
988216593 5:28282648-28282670 AAAAAAAAACAGGGTGGGGTGGG - Intergenic
988677505 5:33447541-33447563 CTTAAGAAACTGACTGGGGCAGG - Intronic
989158451 5:38367256-38367278 AAAAAAAAAAAGTCTGGGGTGGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990817800 5:59805087-59805109 ATTAAGAAACAGAATGTGGCAGG - Intronic
991383016 5:66051904-66051926 AAAAAGAGACAGATTGGGGTTGG + Intronic
991599808 5:68341006-68341028 ATTAAGAAAAAGCCTGGGCTAGG - Intergenic
991640587 5:68747840-68747862 ATAAATAAAATGACTGGGTTGGG - Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992253507 5:74898878-74898900 ATAAAGAAACAGAACAGGGCTGG - Intergenic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993764296 5:91836084-91836106 ATAAAGAGACAGAGGGGGGCTGG - Intergenic
995563098 5:113404160-113404182 ATAAAGAAACAAACTGGGCCGGG - Intronic
995972760 5:117992673-117992695 GTAGAGAAATAGATTGGGGTGGG + Intergenic
996312431 5:122121974-122121996 ATAAAGCAAAAGACTGGCGAAGG - Intergenic
996531301 5:124530066-124530088 ATAAACAAACAAACTGGGCGCGG - Intergenic
997798770 5:136838837-136838859 ATAAAAGTACAGAGTGGGGTGGG - Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
998959811 5:147473025-147473047 CAAAAGAAAAAGACTTGGGTTGG - Intronic
999146519 5:149399514-149399536 ATAAAGAAACAAATTTGGGTGGG + Intronic
1000386366 5:160678305-160678327 ATAAAGCCTCAGGCTGGGGTTGG + Intronic
1000901662 5:166918548-166918570 AAAAAGAAACATATTGGGTTAGG + Intergenic
1001450922 5:171823669-171823691 ATAAAGAAGAAAACTGAGGTTGG - Intergenic
1001561528 5:172672542-172672564 ATAAGGAAATAGAGTGGGGGGGG - Intronic
1001995130 5:176151270-176151292 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1002083627 5:176753940-176753962 ATAAACATACAGACTGGGTGTGG - Intergenic
1002122868 5:177019242-177019264 ATAAAGAAACAGACTAGGAAAGG - Intronic
1002907891 6:1465666-1465688 ATAAATAAACAGGCTGGGCATGG + Intergenic
1003202657 6:3976408-3976430 ATTAAAAAACTGACTGGGCTGGG - Intergenic
1003483424 6:6553942-6553964 ACAAACAAACAAACTGCGGTAGG + Intergenic
1003849544 6:10207778-10207800 ATAAAGAAACAGAGCAGGCTGGG + Intronic
1004014809 6:11722621-11722643 ATAAAAAAATATTCTGGGGTGGG + Intronic
1004165121 6:13249999-13250021 ACAAAGACAGAGAGTGGGGTGGG - Intronic
1004616571 6:17296089-17296111 AGAAAGGTACAGCCTGGGGTAGG - Intergenic
1004700215 6:18071739-18071761 TTATAGAAGCAGACTGGGGTGGG - Intergenic
1005701706 6:28407723-28407745 ATAAGTAAAGAGACTGGGATAGG + Intergenic
1006289815 6:33126096-33126118 ATAAAGAAAAACACAGGGGTAGG + Intergenic
1006486667 6:34348485-34348507 AAAAAGAAACAGGCTGGGAGCGG + Intronic
1006653226 6:35568457-35568479 ATAAATAAATAGGCTGGGCTCGG - Intergenic
1006657598 6:35609080-35609102 ATAATGAAACAGTCTGGCCTGGG - Intronic
1006810386 6:36816766-36816788 ACAAACAAACATACTGGGGACGG - Intronic
1007126133 6:39427162-39427184 ATACAGACACAGACTGGAGGGGG - Intronic
1008067058 6:47061276-47061298 ACAAAGTAAGAGACTGGGGGAGG - Intergenic
1008752046 6:54746705-54746727 TTAAAGAAACAGGCTGGGCTTGG - Intergenic
1008803686 6:55401953-55401975 AAAAAGAAACAGAGAGGGGAGGG - Exonic
1010388522 6:75310056-75310078 ATAAGGAAGCAAACTGGGGTTGG - Intronic
1010486903 6:76425678-76425700 AGAGAGAAACAGAATGGGATGGG + Intergenic
1010777823 6:79907078-79907100 ATAAAGAAACAAACAAGGGATGG + Intergenic
1010880752 6:81167406-81167428 ATAAACAAAGATACTGAGGTAGG - Intergenic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011701053 6:89955206-89955228 AAGAAGAAACAGACTGGACTTGG - Intronic
1012099448 6:95012292-95012314 ATACAGAAACAGGCTGGGTGTGG - Intergenic
1012509320 6:99984409-99984431 AAAAACAAAAAGACGGGGGTGGG - Intronic
1012675662 6:102108240-102108262 ATCAAGAAACAGAGAGGGGTTGG + Intergenic
1012907539 6:105085493-105085515 TTATAGACACAGACAGGGGTAGG - Intergenic
1012921564 6:105225507-105225529 ATAAAGAAAGTGACAGGGGCTGG - Intergenic
1013167410 6:107606427-107606449 AAAAAGTAACAGGTTGGGGTGGG + Intronic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1015001855 6:128227176-128227198 ACAAAGAAACATAATGGGATTGG + Intronic
1015083317 6:129255109-129255131 ATTAAAAAACAGCCTGGGGCCGG + Intronic
1015218915 6:130781993-130782015 ATAAATAAACCCACTGGAGTTGG - Intergenic
1015928031 6:138329677-138329699 ACAAAAAAACAAACTGGGTTTGG + Intronic
1016043622 6:139458639-139458661 AAAAAGAAAAAGATTGGGCTGGG - Intergenic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1017168337 6:151431402-151431424 ATAGACAAACAGACTGGTGGTGG + Intronic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017892665 6:158652216-158652238 ATAAATAAACAGGCTGGGCTCGG - Intronic
1018301440 6:162406861-162406883 CTAAATAAAAATACTGGGGTGGG - Intronic
1018677439 6:166235455-166235477 CAAAAGCATCAGACTGGGGTTGG + Intergenic
1020585146 7:10055994-10056016 ATAAATAAAAAGATTTGGGTGGG - Intergenic
1020864530 7:13540921-13540943 AGAAAGAAACAGATTAGTGTAGG + Intergenic
1021713494 7:23439775-23439797 ATAAACAAAGAAACTGAGGTGGG + Intronic
1021713824 7:23442686-23442708 TGAAAAAAACAGACTGGGCTCGG - Intronic
1022572114 7:31465040-31465062 GGAAAGAGACAGGCTGGGGTAGG + Intergenic
1022593813 7:31692281-31692303 ATAAAGAAACAGGATTGGATTGG + Intronic
1022731432 7:33030372-33030394 ATAAAAACACAGACTTGGTTTGG + Intronic
1022846879 7:34219278-34219300 TAAAAGAAAGAGACTGGGCTGGG - Intergenic
1022872162 7:34490840-34490862 AAATAGAAACAGCCTGGGTTTGG + Intergenic
1023003604 7:35838674-35838696 ACAAAGAAAAAGACTGAGGTCGG - Intronic
1023364160 7:39446327-39446349 ATAAAGAAACTCACTTGGGGAGG - Intronic
1023780916 7:43654256-43654278 ATATAGAAACAGAGTGGGGTGGG - Intronic
1023801877 7:43842174-43842196 ATAAAGAAACAAATTAGGCTAGG + Intergenic
1024121222 7:46243405-46243427 AAAAAAAAGCAGACTGGTGTGGG + Intergenic
1024493062 7:50008878-50008900 ATAAAGACACATACTGGGCCAGG + Intronic
1024740291 7:52346520-52346542 ATAAACAAACAGACAAGGGGAGG - Intergenic
1024925979 7:54616541-54616563 GTCAAGAAACAGACTGCTGTTGG + Intergenic
1025625907 7:63221481-63221503 TTACAGAAACAGGCTGGGGGCGG + Intergenic
1025656208 7:63521654-63521676 TTACAGAAACAGGCTGGGGGCGG - Intergenic
1026182970 7:68058344-68058366 CTAAAGACAGGGACTGGGGTGGG - Intergenic
1028407285 7:90489731-90489753 ATAAAGAACCAAAGTGGAGTAGG + Intronic
1029089303 7:98035614-98035636 AAAAAGAAAGAGAAGGGGGTTGG + Intergenic
1029164450 7:98577315-98577337 AGAAAGAAACAGCCTGGGTGTGG + Intergenic
1029246587 7:99206450-99206472 ATAAAAAACCAGGCTGGGCTGGG - Intronic
1029278699 7:99423359-99423381 ATAAAGGAACAGAGTGGGAAGGG + Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029319989 7:99750337-99750359 ACAAAGGAAGAAACTGGGGTGGG - Intergenic
1029918608 7:104238322-104238344 ATAAAGAGACAGAGAGAGGTTGG + Intergenic
1030164747 7:106542854-106542876 ATAAAGAAAAATGCTGGGGTTGG + Intergenic
1030352682 7:108507362-108507384 AAAAAGAAACAGGCTGGGTGAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032120847 7:129154761-129154783 ATAAACTAACAAATTGGGGTGGG + Intronic
1032182403 7:129691648-129691670 ATAAAGAAATAGGGTGGGCTGGG - Intronic
1032681997 7:134194584-134194606 ATAAAGAATTAGCCTGGTGTAGG + Intronic
1033942353 7:146671375-146671397 AAAAAGAAAGAGACAGAGGTGGG - Intronic
1034618375 7:152437020-152437042 ATAAGGAAACTAACTGGCGTTGG - Intergenic
1034904351 7:154930722-154930744 ACACAGAAACTGACTGGGTTAGG - Intronic
1035481894 7:159193517-159193539 AGAAAGAGACAGACTGCAGTAGG + Intergenic
1035904346 8:3492836-3492858 ATAAAGTAACAGACATGGGGGGG - Intronic
1036414629 8:8535578-8535600 ATGGAAAAAGAGACTGGGGTGGG + Intergenic
1036493848 8:9251798-9251820 ATATAAAAACAGGCTGGGGCTGG + Intergenic
1037472504 8:19224444-19224466 AGAAAGAGACAGAGTGTGGTCGG + Intergenic
1037780498 8:21865192-21865214 CAACAGAAACAGACAGGGGTTGG + Intergenic
1039898450 8:41733026-41733048 AAAATGAAACAGACTGGGCGCGG - Intronic
1040659094 8:49548525-49548547 ATACAGTAACAGTGTGGGGTAGG + Intronic
1041436793 8:57850728-57850750 AAAATGATACAGACTGGGGGAGG - Intergenic
1041980520 8:63853155-63853177 ATAAAGACAGAGAGTGTGGTGGG - Intergenic
1042426083 8:68650466-68650488 AAAAAAAAAAAGACTAGGGTGGG - Intronic
1042752315 8:72171276-72171298 TTAAAGAAACAGAATGGGCCTGG + Intergenic
1042807817 8:72790998-72791020 ATGAATAAACAGACTGGCTTGGG + Intronic
1043926867 8:86046534-86046556 AAAAAGAATAAGTCTGGGGTGGG - Intronic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1045066919 8:98456487-98456509 ATAAAGAAGATGACTGTGGTAGG + Intronic
1045682560 8:104678574-104678596 AAAAAGAAAAAAACCGGGGTTGG + Intronic
1045828026 8:106424226-106424248 GTAAAGAATCAGACTGGGTGTGG - Intronic
1046215909 8:111146655-111146677 ATGAAGAAACACCATGGGGTGGG - Intergenic
1046515569 8:115255031-115255053 GGAAAGAAAGAGAGTGGGGTGGG + Intergenic
1047163852 8:122414109-122414131 AAAAACAAACAGACTAGGCTTGG + Intergenic
1047550759 8:125870077-125870099 ATATAGAAACTCTCTGGGGTTGG - Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1047920032 8:129625854-129625876 AGAAAAAGACAGACTGGGCTGGG - Intergenic
1047964112 8:130033017-130033039 ATAATGAAACAGACTCGGCTGGG + Intergenic
1048276862 8:133072828-133072850 TAAACGAAACAGACAGGGGTAGG - Intronic
1049416575 8:142498158-142498180 AGGAAGAAAGAGACAGGGGTAGG - Intronic
1049463006 8:142738817-142738839 ATAGGGAAACAGACTAGGGCAGG + Intergenic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1052902674 9:33807519-33807541 AGAAAGAAACAAAAGGGGGTTGG - Intergenic
1052955768 9:34252135-34252157 CAAAAGAAACAGGCTGGGGTAGG - Exonic
1053077520 9:35146281-35146303 ATAGAGAAACAGCATGGGCTGGG + Intergenic
1055113449 9:72582923-72582945 ACAAATAAACAGACAGGGCTGGG + Intronic
1056257170 9:84811916-84811938 AAAAAGGAACAGGGTGGGGTGGG - Intronic
1056319693 9:85424593-85424615 TTAAAGAAATAGACTTGGCTGGG - Intergenic
1057255955 9:93547248-93547270 ACAAAGATGCAGACTGGGTTAGG + Intronic
1058443165 9:105029274-105029296 ATAAAGAATCAGGATGGGCTGGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058804061 9:108573332-108573354 ATAAAGAAACAGAGTGGCTAGGG + Intergenic
1058854675 9:109049502-109049524 ACAAAAAAACAGACTGGGCGCGG - Intronic
1059502508 9:114767006-114767028 ATAAGGAAACAGGCTGGGCATGG - Intergenic
1059551688 9:115235587-115235609 AGACAGAAACTGATTGGGGTGGG - Intronic
1059686310 9:116640201-116640223 ATTGAGAAATAGACTAGGGTTGG + Intronic
1060732226 9:126046085-126046107 ATAGACTAACAGACTGGGGGAGG + Intergenic
1060915595 9:127387848-127387870 ATAAATAAATAAACTGGGCTAGG + Intronic
1061030334 9:128078123-128078145 ATAAGGAAACAGACTTGGAGAGG - Intronic
1061048351 9:128179627-128179649 AAAAAGAAACAGTCTTGGGCTGG - Intronic
1061124199 9:128663450-128663472 ACAAAGACACAGGCTGGGCTGGG + Intergenic
1061755596 9:132809869-132809891 ATAAATAAGCAGGCTGTGGTCGG + Intronic
1062104764 9:134748946-134748968 AAAAAGAAAGAGACTGGGCGCGG + Intronic
1062505741 9:136875000-136875022 ATAAAGAAACTGATGGGGCTGGG + Intronic
1185958176 X:4515107-4515129 AGCAAGAGACAGAGTGGGGTAGG + Intergenic
1186838028 X:13457327-13457349 ATAAAGAAAGTGTCTTGGGTGGG - Intergenic
1187124119 X:16437598-16437620 ATAAGAAAAGACACTGGGGTTGG - Intergenic
1187685407 X:21810969-21810991 AAAAAGAAAGAGAATGGGCTGGG - Intergenic
1188421312 X:29993346-29993368 GGAAAGGTACAGACTGGGGTTGG + Intergenic
1188691583 X:33136022-33136044 ATAAAAAATCAGGCTGGGTTTGG + Intronic
1189250172 X:39594587-39594609 ACAAAGAAAAAGAGTGAGGTTGG - Intergenic
1189259238 X:39666395-39666417 ACAAGGAAACAGGCTGGGGCAGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190331764 X:49240263-49240285 AAAAAAAAAAAGACTGGGGACGG + Intronic
1190942644 X:55057128-55057150 GTAGAGAAATAGACTGTGGTGGG + Intergenic
1193140492 X:78021902-78021924 AGAAAGAATCAGTCGGGGGTAGG - Intronic
1193686804 X:84586821-84586843 AAAAAAAAAAAAACTGGGGTGGG - Intergenic
1193703243 X:84789865-84789887 AAAAAGAATAATACTGGGGTAGG + Intergenic
1194300929 X:92184894-92184916 ATAAATAAATAAACTGGGATTGG + Intronic
1194951421 X:100131155-100131177 AAAAACAAACAGACTTGGGAAGG + Intergenic
1196243328 X:113369153-113369175 ATGAAGAAAGAAACTGAGGTTGG + Intergenic
1196478651 X:116120319-116120341 GTAAAGAAAAAGATAGGGGTAGG - Intergenic
1196945346 X:120818990-120819012 ACAAAGAAAGAGACTTGGGAAGG + Intergenic
1197160872 X:123320500-123320522 AGGAAGAAAAAGACTGGGATTGG + Intronic
1197948707 X:131871256-131871278 AGAAAGAAACAGGCTGGGCGCGG + Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1201938560 Y:19434031-19434053 ACATAGTAAAAGACTGGGGTGGG - Intergenic