ID: 903132808

View in Genome Browser
Species Human (GRCh38)
Location 1:21290433-21290455
Sequence GGTCCCGCTGCCCGGGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903132796_903132808 10 Left 903132796 1:21290400-21290422 CCACACGCCCCGCATGCTGTGCC 0: 1
1: 0
2: 0
3: 14
4: 139
Right 903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 175
903132798_903132808 2 Left 903132798 1:21290408-21290430 CCCGCATGCTGTGCCCCAGACGC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 175
903132799_903132808 1 Left 903132799 1:21290409-21290431 CCGCATGCTGTGCCCCAGACGCC 0: 1
1: 0
2: 0
3: 25
4: 201
Right 903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 175
903132795_903132808 20 Left 903132795 1:21290390-21290412 CCGGGGGCGGCCACACGCCCCGC 0: 1
1: 0
2: 0
3: 22
4: 194
Right 903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 175
903132797_903132808 3 Left 903132797 1:21290407-21290429 CCCCGCATGCTGTGCCCCAGACG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903132808 Original CRISPR GGTCCCGCTGCCCGGGTGGC CGG Exonic