ID: 903132915

View in Genome Browser
Species Human (GRCh38)
Location 1:21290763-21290785
Sequence CAATCAAGACAGGTTCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903132905_903132915 30 Left 903132905 1:21290710-21290732 CCCAGTGGCAGATAACAAAAGTA 0: 1
1: 0
2: 1
3: 25
4: 199
Right 903132915 1:21290763-21290785 CAATCAAGACAGGTTCCCCCCGG 0: 1
1: 0
2: 2
3: 3
4: 88
903132911_903132915 -5 Left 903132911 1:21290745-21290767 CCTCGATGTGGCCCAGAGCAATC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 903132915 1:21290763-21290785 CAATCAAGACAGGTTCCCCCCGG 0: 1
1: 0
2: 2
3: 3
4: 88
903132910_903132915 -4 Left 903132910 1:21290744-21290766 CCCTCGATGTGGCCCAGAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 69
Right 903132915 1:21290763-21290785 CAATCAAGACAGGTTCCCCCCGG 0: 1
1: 0
2: 2
3: 3
4: 88
903132906_903132915 29 Left 903132906 1:21290711-21290733 CCAGTGGCAGATAACAAAAGTAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 903132915 1:21290763-21290785 CAATCAAGACAGGTTCCCCCCGG 0: 1
1: 0
2: 2
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903132915 Original CRISPR CAATCAAGACAGGTTCCCCC CGG Intronic