ID: 903136082

View in Genome Browser
Species Human (GRCh38)
Location 1:21310132-21310154
Sequence ACATTGCCTCAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903136071_903136082 29 Left 903136071 1:21310080-21310102 CCACTGTGCCAGGCCCCAGCTGG 0: 1
1: 3
2: 39
3: 260
4: 1708
Right 903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 24
4: 251
903136073_903136082 21 Left 903136073 1:21310088-21310110 CCAGGCCCCAGCTGGATTTTCTA 0: 1
1: 0
2: 6
3: 55
4: 667
Right 903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 24
4: 251
903136075_903136082 15 Left 903136075 1:21310094-21310116 CCCAGCTGGATTTTCTAACAAAA 0: 1
1: 1
2: 0
3: 20
4: 279
Right 903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 24
4: 251
903136076_903136082 14 Left 903136076 1:21310095-21310117 CCAGCTGGATTTTCTAACAAAAC 0: 1
1: 0
2: 1
3: 8
4: 301
Right 903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 24
4: 251
903136074_903136082 16 Left 903136074 1:21310093-21310115 CCCCAGCTGGATTTTCTAACAAA 0: 1
1: 0
2: 2
3: 24
4: 242
Right 903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 24
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903136082 Original CRISPR ACATTGCCTCAGAGGGAGGG AGG Intronic
900745164 1:4356017-4356039 TGAGCGCCTCAGAGGGAGGGAGG - Intergenic
901010151 1:6196246-6196268 GGAATGGCTCAGAGGGAGGGAGG + Intronic
901401454 1:9017757-9017779 CCATTGCCTGAGAGCGAGTGGGG - Intronic
902587826 1:17451861-17451883 TCCTTGCTTCAGAGGGAAGGAGG + Intergenic
903000500 1:20262188-20262210 AGATTGCCCCAGCGGGAGGGTGG - Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG + Intronic
904901710 1:33862751-33862773 TCATTGGCTCACAGGGAGGAAGG + Intronic
910741782 1:90527141-90527163 ACAATGTTTCAGAGGGAGGAAGG + Intergenic
912950317 1:114116259-114116281 ACACTGCCTCAGGGGAAGGAGGG + Intronic
913078938 1:115364152-115364174 ACATGGCACCAGAGGGAGTGTGG + Intergenic
916438725 1:164801054-164801076 ACATTGACTAAAAGGGAGTGAGG - Intronic
919988467 1:202692128-202692150 TCACTGCGACAGAGGGAGGGAGG + Intronic
920051686 1:203168197-203168219 GCATTGCACCTGAGGGAGGGAGG - Intronic
920205455 1:204287777-204287799 ACAATGGCTCAGAGAGAAGGAGG + Intronic
920219352 1:204385170-204385192 ACAGTTCCCCAGAGGGAGAGGGG + Intergenic
920703283 1:208233786-208233808 ACAGTGCCTCTCGGGGAGGGAGG + Intronic
921947488 1:220896069-220896091 ACATTGTTTTAGAGGGCGGGTGG + Intergenic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
923698182 1:236275501-236275523 ACATTGACTTATTGGGAGGGTGG - Intronic
1062912918 10:1225278-1225300 ACATAGGCTCAAAGGGATGGAGG - Intronic
1062918234 10:1258433-1258455 ACATAGGCTCAAAGGGATGGAGG + Intronic
1062980221 10:1716009-1716031 ACACTGACTCAGCGGGCGGGAGG - Intronic
1063915604 10:10878913-10878935 ACAATGCATCTGAGGGAGGTGGG - Intergenic
1064403559 10:15040916-15040938 ACAGTGCTTAAGAGGGAGGCAGG - Intronic
1064821689 10:19342829-19342851 ACACTGCCACAGAGAGAGGAGGG - Intronic
1064945116 10:20778521-20778543 ACTTTGCCTAACAGGGATGGTGG - Intergenic
1065122075 10:22540127-22540149 GCATTGCTGCTGAGGGAGGGAGG + Intronic
1066657975 10:37712639-37712661 GCCTGGCCTCAGAGGGTGGGAGG + Intergenic
1067042453 10:42962261-42962283 GCTTGGCCTCAGAGGGTGGGAGG + Intergenic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1069845129 10:71365647-71365669 TCATTCCCTCCCAGGGAGGGAGG + Intergenic
1072852497 10:98910926-98910948 AAATTTCCTCAGATAGAGGGTGG - Intronic
1074288413 10:112120061-112120083 ACATGGCCTGAGAGTAAGGGCGG - Intergenic
1074341038 10:112630352-112630374 AAATTTCCTCAGAGGGCTGGAGG - Intronic
1075138394 10:119808230-119808252 ACATTACATCAGAGGGAGAGGGG + Intronic
1076017493 10:127039903-127039925 ACATGGTCTTAGAGAGAGGGTGG + Intronic
1076373444 10:129968789-129968811 AACTTGCCTCAGAGGGCAGGCGG - Intergenic
1076590171 10:131577327-131577349 AAAGTGCCTCAGAAGGATGGTGG + Intergenic
1077402033 11:2363751-2363773 ACATTCCGCCAGAGGGAGAGTGG + Intergenic
1078081347 11:8206850-8206872 ACATTTGTTCAGAGGGAGGGTGG - Intergenic
1079345692 11:19650269-19650291 ACATAGACACAGAGGGAAGGTGG + Intronic
1079358897 11:19753896-19753918 TTATTTGCTCAGAGGGAGGGTGG + Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1080787136 11:35485765-35485787 ACAGAGCCTTAGAAGGAGGGAGG - Intronic
1080828668 11:35870928-35870950 CCATTGCCTGAGAGGGAGGAGGG - Intergenic
1081264625 11:41005087-41005109 ACATCACATCAGGGGGAGGGAGG - Intronic
1082004489 11:47412150-47412172 AGCTTGCCTGGGAGGGAGGGAGG + Intronic
1085290309 11:75394435-75394457 AGAGTGGCTCAGAGGGAGGTGGG - Intergenic
1085466834 11:76729872-76729894 ACAGCACATCAGAGGGAGGGAGG - Intergenic
1087409123 11:97768183-97768205 ACATGGCATGAGAGGGAGGAGGG + Intergenic
1088594068 11:111426766-111426788 ACACTGCATCAGAGGCAGGCAGG + Intronic
1090733193 11:129589410-129589432 CCATTCCCTCCCAGGGAGGGAGG + Intergenic
1091041255 11:132283992-132284014 GCATTGCCTCAGAGGGAGGAAGG - Intronic
1092077808 12:5687745-5687767 TCATTCCCTCTGAGGCAGGGAGG + Intronic
1092891767 12:12975515-12975537 ACATGACCTCTGAGAGAGGGGGG + Intronic
1094153291 12:27310373-27310395 GCATAGCCTCAGAGACAGGGAGG + Intronic
1096216127 12:49798365-49798387 ACAGTGCCCCAGAGGCAGCGGGG + Exonic
1097247806 12:57616179-57616201 ACATTGGCTGACAGGGAGGGAGG + Intronic
1097991274 12:65836624-65836646 GCATTGCCTCATGGAGAGGGAGG - Intronic
1098830231 12:75352282-75352304 ACATAGACTCAAAGGGATGGAGG + Intronic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1105432788 13:20352294-20352316 ACAGTGCAGGAGAGGGAGGGGGG - Intergenic
1105852089 13:24344107-24344129 ACATAGACTCAAAGGGATGGAGG + Intergenic
1106123655 13:26882585-26882607 ACAACTCCTCTGAGGGAGGGCGG - Intergenic
1108380130 13:49847214-49847236 GCCTTGCATGAGAGGGAGGGAGG + Intergenic
1108761806 13:53576246-53576268 TCTCTGGCTCAGAGGGAGGGAGG - Intergenic
1109649673 13:65309856-65309878 ACCTGGCTTCAGAGGCAGGGTGG + Intergenic
1109966566 13:69706563-69706585 ATATTGCCTCAGTGGGTGGAAGG - Intronic
1110620314 13:77587183-77587205 TCATTGACTCAGAGTGAGGAAGG - Intronic
1112509213 13:99993980-99994002 AAATTGCCTCAGAGAGGAGGTGG - Intergenic
1113671557 13:112178965-112178987 CCACAGCCTCACAGGGAGGGAGG - Intergenic
1113704633 13:112419753-112419775 AGATTGCCTGAGAGTGAGGCTGG + Intronic
1114204472 14:20555660-20555682 ACATCACCTCAGAGAGAGGCTGG - Intergenic
1114598865 14:23937533-23937555 ACATTCCCTCAGAGGGCTTGGGG + Intergenic
1114805660 14:25833508-25833530 ACATAGCCTCTGAGGGAAGCAGG - Intergenic
1115634272 14:35276297-35276319 ACCCTGTCTCAAAGGGAGGGAGG + Intronic
1116918328 14:50547052-50547074 ACATGGACACAGGGGGAGGGGGG + Intronic
1118231529 14:63955280-63955302 GCTTTAACTCAGAGGGAGGGAGG - Intronic
1120840159 14:89078509-89078531 ATCTTGCCTCACAGGGAAGGAGG - Intergenic
1121306287 14:92909711-92909733 AGATTGCTTCAGAGGAAGGCAGG - Intergenic
1122034626 14:98938339-98938361 GCACTGCCTCAGAGAGAGGCTGG - Intergenic
1122460221 14:101888469-101888491 CCAAAGCCTAAGAGGGAGGGAGG - Intronic
1122894604 14:104750321-104750343 ACACTGCCTCTGAGGGGGCGTGG + Intergenic
1124874771 15:33581492-33581514 ACATTCCCTGAGAAGGAGAGTGG - Exonic
1125201262 15:37102037-37102059 ACTTTCCCGCGGAGGGAGGGTGG + Intergenic
1125836374 15:42755061-42755083 AAATTACCTCAGTGGAAGGGGGG - Intronic
1127417339 15:58770885-58770907 ACAATGCCTCAGGCCGAGGGTGG + Intergenic
1127860232 15:62988034-62988056 ATACTGCCTTAGAGGGAGGAAGG - Intergenic
1128249636 15:66155321-66155343 AATTTGCCTCAGAGTGAGGGCGG + Intronic
1128549943 15:68591567-68591589 ACATTGCCCTAGAGGCAGAGAGG + Intronic
1128637092 15:69309593-69309615 ACATTGCCTCTGAGGAGGGAGGG - Intronic
1128722095 15:69957580-69957602 AGATTACCTGAGAGGAAGGGAGG - Intergenic
1131907507 15:97159215-97159237 TCTTTGCCTCGGAGGTAGGGAGG + Intergenic
1132575376 16:661495-661517 ACACTGGGTCAGTGGGAGGGAGG + Exonic
1132629814 16:911730-911752 ACACTGCCTCACATGGAGGCTGG - Intronic
1134016049 16:10889196-10889218 ACATTGCCAGAGCGGGATGGAGG - Intronic
1135003993 16:18801936-18801958 CCGTTGCCTCAGGCGGAGGGCGG + Intergenic
1135937274 16:26792022-26792044 ACATGGACTGAGAGTGAGGGAGG - Intergenic
1135955881 16:26955831-26955853 GCAGTGCCTCAGAGGGGGTGGGG + Intergenic
1136478682 16:30527802-30527824 AGATTTCCTCACAGGGAGGCAGG + Intronic
1136932550 16:34432307-34432329 ACACAGCCACAGAGGGAGAGAGG - Intergenic
1136972022 16:34979507-34979529 ACACAGCCACAGAGGGAGAGAGG + Intergenic
1137434134 16:48441729-48441751 ACCTTGCCTCAAAGGGAGGCTGG - Intronic
1138773222 16:59689074-59689096 CTCTTGTCTCAGAGGGAGGGAGG + Intergenic
1139880161 16:70175168-70175190 ACCTTGCCCCTGAGGGACGGAGG + Intronic
1140014200 16:71165727-71165749 ACATGGCGTGAGGGGGAGGGGGG + Intronic
1140372348 16:74420349-74420371 ACCTTGCCCCTGAGGGACGGAGG - Intronic
1141422446 16:83925766-83925788 GCATTGCCTGGGAGGCAGGGAGG - Exonic
1141660157 16:85437158-85437180 AGATGGCCTCAGAGGGTTGGGGG - Intergenic
1142274569 16:89110819-89110841 ACACTGCCATCGAGGGAGGGAGG - Intronic
1142580041 17:936337-936359 GCAGTGCCTCAGAGGGAGGGCGG - Intronic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1143261750 17:5604547-5604569 CCATTATCTCAGAGGGAGTGAGG + Intronic
1144132900 17:12265451-12265473 CCAGTGCCTCAGAGGGAGTGTGG - Intergenic
1145248240 17:21283829-21283851 ACCGTGTCTCAGAGGGAGTGAGG - Intergenic
1146314040 17:31793340-31793362 ACAGTCCCGCAGAAGGAGGGAGG + Intergenic
1147510362 17:41063697-41063719 ACAATGCCTTATGGGGAGGGAGG + Intergenic
1150294915 17:64002419-64002441 TCATTGCTACTGAGGGAGGGTGG - Exonic
1151574655 17:74946645-74946667 TCATTGCCTGGGAGGGAGGCAGG - Exonic
1151948278 17:77331292-77331314 TCACTGCGTCAGAGGGAGAGAGG + Intronic
1152425890 17:80218498-80218520 ACATTGCCTCTGAGGGAGCTGGG - Intronic
1152598699 17:81250710-81250732 ACACACCCTCAGAGGGCGGGTGG + Intronic
1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG + Intergenic
1160186138 18:76677972-76677994 ACATTTGCTCAGAGCGAGGAAGG - Intergenic
1160744430 19:704055-704077 ACATTGCCTGGGATGCAGGGAGG + Intergenic
1163138879 19:15332795-15332817 ACAGACCCTCACAGGGAGGGAGG + Intergenic
1165148890 19:33749687-33749709 ACAGTGCCTGGGAGGGAGGTGGG - Intronic
1165358523 19:35319098-35319120 ACAGTGACTCAGAGAGATGGGGG + Intergenic
1165882091 19:39051523-39051545 ACATTGCCTGCCAGGGACGGTGG + Intergenic
1165903374 19:39179038-39179060 ACAATGGCTCAGGGGGAGAGGGG - Exonic
1166116253 19:40656825-40656847 TCATTGCAACACAGGGAGGGTGG - Intergenic
1166872625 19:45880062-45880084 AAATTGAATCAGAGGGATGGTGG - Intergenic
1167315843 19:48762293-48762315 ACATAGGCCCAGAGAGAGGGGGG + Intergenic
1168153650 19:54461808-54461830 ACATGGCAGAAGAGGGAGGGAGG - Exonic
927215033 2:20663612-20663634 AGATTGCCTCCAACGGAGGGAGG - Intergenic
929171207 2:38934681-38934703 ACAGTGCCTGAGATGGAGGGAGG - Intronic
931185525 2:59947363-59947385 ACTTTGCCTGAAAGGGAGGAAGG - Intergenic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
933865173 2:86509494-86509516 AAATTCCCTGAGAGGAAGGGAGG + Intronic
935541991 2:104359243-104359265 TCTTTGCCTCAATGGGAGGGTGG - Intergenic
936234233 2:110730004-110730026 ACATTGGCTTAGAGGCTGGGAGG - Intergenic
938933882 2:136111810-136111832 ACACAGCCTCAGAGGGAGGCTGG - Intergenic
940133701 2:150412561-150412583 ACATGGCCTCAGAGTCAGGGAGG - Intergenic
941512116 2:166424993-166425015 ACATTGCCTCTCAGGCGGGGTGG - Intronic
943074826 2:183180990-183181012 TCATTGCCTCAGATGGAGGTAGG - Intergenic
943548235 2:189308204-189308226 CCCTTGGCTGAGAGGGAGGGGGG - Intergenic
944249379 2:197566341-197566363 ACATAGACTCAAAGGGACGGAGG - Intergenic
944434906 2:199677552-199677574 GCATTGCCTAAGAGAGATGGTGG + Intergenic
945381732 2:209148213-209148235 AAATTGCATCAGAGGGAGATAGG + Intergenic
945806892 2:214501242-214501264 ACACTTCATCAGAGGGAAGGTGG - Intronic
946436313 2:219658192-219658214 TCCTTGCCTCACAGAGAGGGGGG + Intergenic
946518806 2:220443614-220443636 CCATTTGCTCAGAGTGAGGGAGG + Intergenic
946631353 2:221672463-221672485 ACAGAGCCACAGAGGAAGGGTGG - Intergenic
947742689 2:232491848-232491870 ACATTGCTCCAGAGGTTGGGAGG - Intergenic
948362526 2:237433023-237433045 ACTTTGCCCCTGAGGGAGGATGG - Intergenic
948636542 2:239341466-239341488 ACACTACCTAACAGGGAGGGAGG + Intronic
948710613 2:239822740-239822762 ACATGGCCGGAGAGGGAGGAAGG - Intergenic
1169935335 20:10877587-10877609 CCTTTGCCTCAAAGAGAGGGAGG + Intergenic
1170882206 20:20306681-20306703 ACGTTGACTCAGTGGGTGGGGGG - Intronic
1172771179 20:37383534-37383556 ACAGTGACTCAGGGGGAGGTGGG + Intronic
1173068944 20:39742668-39742690 CCATTGCCTTATAGGGAGGGTGG + Intergenic
1174760263 20:53200237-53200259 ACATTGCCACTGTGGCAGGGAGG - Intronic
1175916062 20:62426580-62426602 CCATTACCACAGAGGGTGGGAGG - Intronic
1176030511 20:63009077-63009099 ACCTTGGCTCAGAGGGTTGGAGG + Intergenic
1179597889 21:42455311-42455333 GCATTGCCTCACAGTCAGGGTGG + Intergenic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1182900059 22:33890251-33890273 ACAATGCCTCAGATGCAAGGCGG + Intronic
1183024213 22:35051948-35051970 ACATTGCCTCAGAGGTATCAGGG + Intergenic
1183348047 22:37318783-37318805 ACATTGCCAGACAGGGAGGGAGG - Intergenic
1183418747 22:37697775-37697797 ACAGAGCCCCAGGGGGAGGGTGG - Intronic
949332589 3:2938716-2938738 TCATTTCCTGAGAGGGAGAGAGG + Intronic
949583632 3:5415098-5415120 ACATAGGCTCAAAGGGATGGAGG + Intergenic
949894176 3:8757027-8757049 ACACTGGCTGAGAGGCAGGGAGG + Intronic
950128747 3:10527566-10527588 TCCTTGTCTCAGAGGGAGAGTGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
953906445 3:46870664-46870686 ACATAGCCACACTGGGAGGGTGG - Intronic
953997099 3:47528226-47528248 ACATAGCCTCAGAGGAATGTTGG + Intergenic
955777137 3:62446051-62446073 ACTTTTTTTCAGAGGGAGGGAGG - Intronic
958556701 3:95687468-95687490 ACATTGCATGAGAGTAAGGGTGG - Intergenic
960713004 3:120549786-120549808 ACATTGCCTCCCAGGGTGGGTGG + Intergenic
960950868 3:122997663-122997685 TCTTTGCTGCAGAGGGAGGGAGG - Intronic
961333513 3:126156674-126156696 ACATGGCCTGAGCGGCAGGGCGG - Intronic
961364699 3:126391910-126391932 ACGTTCCCAGAGAGGGAGGGGGG + Intergenic
962474708 3:135745173-135745195 ACATTGACTCAAAGAGAAGGAGG - Intergenic
963416046 3:144997122-144997144 ACATAGACTCAAAGGGATGGAGG - Intergenic
966223110 3:177570032-177570054 ACATTGACCCACAGGGAGAGGGG - Intergenic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967218537 3:187229895-187229917 ACACTGCATCCAAGGGAGGGAGG + Intronic
968054067 3:195677556-195677578 AGATGGCCTCAGATGTAGGGTGG + Intergenic
968101825 3:195971593-195971615 AGATGGCCTCAGATGTAGGGTGG - Intergenic
968476100 4:809515-809537 ACATGGCCTGAGGGGGTGGGGGG + Intronic
975072538 4:70159587-70159609 ACATGGCCTCAGGAGGAGGAGGG - Intronic
975620844 4:76295009-76295031 GCATGGCCTCAGTGTGAGGGTGG + Intronic
977691618 4:99918129-99918151 ACATAGCCTCAGAGACAGGTGGG - Intronic
979059946 4:116044643-116044665 ACAGTGCCCCAGGGGTAGGGAGG + Intergenic
979788973 4:124754282-124754304 AAATTGCCTAAGATGGAAGGAGG - Intergenic
980609456 4:135138608-135138630 ACATAAGCTCAGAGGTAGGGTGG + Intergenic
983166418 4:164482345-164482367 ACAGGGAGTCAGAGGGAGGGTGG + Intergenic
983417949 4:167482249-167482271 ACACTGCCTCAGGCTGAGGGTGG + Intergenic
985737024 5:1589509-1589531 AGATGGCCTCAGACGTAGGGTGG - Intergenic
985776545 5:1847179-1847201 AAATCGCCTCACAGGGAGTGCGG - Intergenic
986045030 5:4028383-4028405 AAACTTCCCCAGAGGGAGGGTGG - Intergenic
988885085 5:35547890-35547912 ACATTGCCTCTCAGGCAAGGTGG - Intergenic
996728526 5:126694573-126694595 ACATTTCCACACACGGAGGGAGG - Intergenic
998131544 5:139653848-139653870 ACAGGGCCTAGGAGGGAGGGAGG + Intronic
999265433 5:150264234-150264256 ACCTTCCCTCAGAGGATGGGGGG + Intronic
999266658 5:150271017-150271039 AGATTGCCCCAGTGGGAGAGAGG - Intronic
1001315540 5:170638840-170638862 ACATTGCCTCCCAGGGATGCAGG - Intronic
1001858602 5:175033773-175033795 ACCTTGGCTGGGAGGGAGGGAGG + Intergenic
1002401976 5:178996012-178996034 ACACTGCCTTGGATGGAGGGAGG + Intronic
1002629542 5:180561847-180561869 ACACCACCTCAGAGGGAGGAAGG + Intronic
1002723876 5:181282224-181282246 ACACTGCCTAAGGGGGCGGGGGG + Intergenic
1004549095 6:16629333-16629355 ACTCTGCCTCAGGGGGAGGCGGG - Intronic
1006103751 6:31703336-31703358 ACAACACCTCAGAGGCAGGGAGG - Exonic
1006216423 6:32447288-32447310 CCAATGGCTCAGAGGGAGGAAGG - Intergenic
1006350278 6:33515989-33516011 ACATTGACTGGGAGGGAGGAGGG - Intergenic
1007085404 6:39140942-39140964 ACACAGGCTCTGAGGGAGGGGGG + Intergenic
1007311173 6:40947211-40947233 ACTTTGCCTCTGAGAGAGGCAGG + Intergenic
1007340975 6:41191494-41191516 ACCATGGCTCAGAGGAAGGGTGG - Exonic
1007403995 6:41623032-41623054 ACCTTGCCTCAGAGAAAGAGAGG + Intergenic
1007564186 6:42836280-42836302 ATAATGCTTCAAAGGGAGGGGGG + Intronic
1007786076 6:44280084-44280106 ACACTGGTTCAGAGGGAGCGGGG - Exonic
1008307846 6:49926735-49926757 ACATTGCCTGAGGTGGAGGTAGG + Intergenic
1012672246 6:102068741-102068763 ACATTCACTCAGAAGAAGGGAGG - Exonic
1014021383 6:116594083-116594105 ACATGGCCAGAGAGTGAGGGTGG + Exonic
1014176798 6:118340402-118340424 ACATAGGCTCAAAGGGATGGAGG - Intergenic
1018501808 6:164419313-164419335 ATATTGACTCAGAGGGAGGTAGG + Intergenic
1019739905 7:2667515-2667537 ACATTGAACCAGAGGGAGGTGGG + Intergenic
1023130601 7:36999107-36999129 GCATTGTCTAGGAGGGAGGGTGG + Intronic
1023329477 7:39099376-39099398 AAATTCCCTTGGAGGGAGGGAGG - Intronic
1024204277 7:47142590-47142612 ACAGTGTTTCAGAGGGTGGGAGG - Intergenic
1024982893 7:55172339-55172361 ACATGACCTCTGTGGGAGGGAGG + Intronic
1025752198 7:64303433-64303455 AAATAGCCTCATGGGGAGGGTGG - Intergenic
1030779905 7:113587533-113587555 CCATTACCTCAGAGGAATGGTGG + Intergenic
1031528713 7:122851385-122851407 CCATGGCCTCAGAGTGAAGGTGG + Intronic
1032791046 7:135242669-135242691 ACTTTGCATCTGAGGGAGCGTGG + Intronic
1038431980 8:27507657-27507679 CCATTGCCTCAAAGGGAAGTAGG + Intronic
1039176873 8:34818342-34818364 ACATTGCCTCAGAGAGAGCTTGG - Intergenic
1039301022 8:36208813-36208835 TCATTGCCTCAAAGGAAGTGTGG - Intergenic
1039517228 8:38144278-38144300 ACCTGGCTTCAGAGGCAGGGTGG + Exonic
1040293113 8:46135585-46135607 ACATTGACGCAGACAGAGGGAGG - Intergenic
1043724967 8:83599826-83599848 ACATAGCCTGGAAGGGAGGGTGG + Intergenic
1044144874 8:88700365-88700387 ACAGTTCCTCAGGGGTAGGGAGG - Intergenic
1045065408 8:98439580-98439602 ACCCTGCCTCAGAGGGATTGGGG - Intronic
1045424737 8:102054178-102054200 CCATTGTCTCAGGGGCAGGGAGG + Intronic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1048574657 8:135681190-135681212 ACATAGCCTCTCAGGGAGGGAGG - Intergenic
1048712262 8:137225440-137225462 AGACTGCCTCAGAGGTAGTGAGG - Intergenic
1049831939 8:144706174-144706196 ACTTCCCCTCAGAGGGAAGGTGG - Intergenic
1050105470 9:2161811-2161833 ACAGTTTCTCAGCGGGAGGGCGG - Exonic
1051407560 9:16755222-16755244 ACATGGCCTCAAATGGAGGGAGG + Intronic
1053073101 9:35112459-35112481 CCAGTGACTCAGTGGGAGGGTGG - Intronic
1055036085 9:71820088-71820110 ACATTGCCTCTGACTGAGGAGGG + Intergenic
1055868320 9:80842618-80842640 CCATGACCTCAGAGGTAGGGGGG + Intergenic
1056316542 9:85395864-85395886 ACATGGCCTCAGATGGAAGGTGG + Intergenic
1056809783 9:89755209-89755231 ACATTGCAGCAGAGGTATGGGGG - Intergenic
1057777579 9:98023373-98023395 ACATTGCCTTATAAGGAGTGGGG - Intergenic
1059696443 9:116734335-116734357 ACAGTGCAGCAGAGGGAGGCAGG + Intronic
1060948032 9:127581859-127581881 ACATGGGATGAGAGGGAGGGAGG - Intergenic
1060948099 9:127582071-127582093 ACATGGGATGAGAGGGAGGGAGG - Intergenic
1061218855 9:129237299-129237321 ACATTTACTCAGAGAGAGGAAGG + Intergenic
1061278754 9:129584984-129585006 ACTTTGCCTCAGAGAGAGGAAGG - Intergenic
1061882522 9:133575292-133575314 CCATGGCCTCTGAGGGAGGAAGG - Exonic
1188573325 X:31616153-31616175 ACATTGCATTAGAGAGAGGCTGG - Intronic
1190131431 X:47752105-47752127 ACATTGCAGCGGAGGGTGGGGGG - Intergenic
1190525924 X:51329706-51329728 TCATTAACTCATAGGGAGGGAGG - Intergenic
1190640844 X:52481900-52481922 ACATAGCCTCATTGGGAAGGGGG + Intergenic
1190646828 X:52530965-52530987 ACATAGCCTCATTGGGAAGGGGG - Intergenic
1192203504 X:69081870-69081892 ACACTGCCTCTGGGGGTGGGCGG - Intergenic
1192252741 X:69426339-69426361 ACATAGCCTCAGTGAGTGGGAGG - Intergenic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1195494870 X:105519373-105519395 ACAGTGCTTCAGAGGGGGGATGG + Intronic
1197765570 X:130057441-130057463 ACAATGCCACAGAGGGGGCGGGG - Exonic
1199010589 X:142754029-142754051 ACATGGCCCCAGAGCTAGGGTGG - Intergenic
1202273836 Y:23095789-23095811 ACAAAGACTCAGAGGGATGGAGG - Intergenic
1202292190 Y:23324888-23324910 ACAAAGACTCAGAGGGATGGAGG + Intergenic
1202426832 Y:24729534-24729556 ACAAAGACTCAGAGGGATGGAGG - Intergenic
1202443959 Y:24940560-24940582 ACAAAGACTCAGAGGGATGGAGG + Intergenic