ID: 903136994

View in Genome Browser
Species Human (GRCh38)
Location 1:21315909-21315931
Sequence GAGTCAGTCAACCTGGGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903136986_903136994 26 Left 903136986 1:21315860-21315882 CCACTCCCTCTGTCTACACAGGC 0: 1
1: 0
2: 3
3: 60
4: 552
Right 903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG 0: 1
1: 0
2: 0
3: 13
4: 139
903136987_903136994 21 Left 903136987 1:21315865-21315887 CCCTCTGTCTACACAGGCAGCGT 0: 1
1: 0
2: 1
3: 9
4: 122
Right 903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG 0: 1
1: 0
2: 0
3: 13
4: 139
903136988_903136994 20 Left 903136988 1:21315866-21315888 CCTCTGTCTACACAGGCAGCGTC 0: 1
1: 0
2: 1
3: 10
4: 107
Right 903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903136994 Original CRISPR GAGTCAGTCAACCTGGGTAC CGG Intronic
901184311 1:7362629-7362651 GAGTGAGTGAACTTGGGTAGAGG + Intronic
902827967 1:18990105-18990127 GAGTCAGGGGACCTGGGTCCTGG + Intergenic
903136994 1:21315909-21315931 GAGTCAGTCAACCTGGGTACCGG + Intronic
903869336 1:26421848-26421870 GAGTCAATGAATCTGGGTAGAGG - Intronic
904399506 1:30246924-30246946 GACTCAGAAAACCTGGGTCCAGG + Intergenic
906315826 1:44785933-44785955 GAATGAGTTAACATGGGTACAGG + Intronic
910147081 1:84092963-84092985 GAGTTATTTAACATGGGTACAGG + Intronic
914436351 1:147663689-147663711 GAGGCAGTGAAGCTGAGTACAGG - Intronic
914689505 1:150012888-150012910 GAGCCAGGCCACCTGGGTTCTGG + Intergenic
917729660 1:177862093-177862115 GAGGCAGTCAACCTAGGTGTTGG - Intergenic
919940066 1:202280410-202280432 GAGTCAGGCAGACTGGGTCCTGG + Intronic
1063398069 10:5711632-5711654 GAGTCAGTCAACATAATTACTGG + Intronic
1063890567 10:10623914-10623936 CAGTCAGACTACCTGGGTTCCGG - Intergenic
1064323774 10:14330136-14330158 GAGTCAGTCCTCCTGGGCCCCGG + Exonic
1066304720 10:34129505-34129527 GAGCCAGGCCACCTGGCTACTGG + Intronic
1067196839 10:44127221-44127243 GAGTCAGAAAGCCTGGGTATGGG + Intergenic
1069842280 10:71347328-71347350 GGGACCGGCAACCTGGGTACTGG + Intronic
1069920551 10:71813069-71813091 GAGTGAGTCCACCTGTGTCCAGG + Intronic
1070491388 10:76980215-76980237 AAGTCAGCCGACCTGGGTCCTGG - Intronic
1070532997 10:77353907-77353929 GACTCAGGCAGCCTGGCTACAGG + Intronic
1070950574 10:80427884-80427906 AAGTCAGCAAACCTGGGTTCAGG - Intronic
1074726510 10:116315740-116315762 GAGTGTGTCTACCTGGGTCCAGG - Intergenic
1080225915 11:29960010-29960032 GTGTCAGTCATCCTGGGCATGGG + Intergenic
1083694753 11:64435218-64435240 GAGTCGGTAGACCTGGGTAAGGG + Intergenic
1083761599 11:64821740-64821762 GAGTCAGGCAGCCTGGATTCTGG - Intergenic
1084285350 11:68127778-68127800 GAGTTGGGCAACCTGGGTTCAGG + Intergenic
1089767028 11:120775383-120775405 GAATCAGGCAGCCTGGGTTCTGG + Intronic
1090271496 11:125389298-125389320 GAGTCAGCTGACCTGGGTTCTGG - Intronic
1092173386 12:6387116-6387138 GAGTAAGAAAACCTGAGTACAGG - Intronic
1092699147 12:11207737-11207759 CAATTAGTGAACCTGGGTACAGG + Intergenic
1100611914 12:96196941-96196963 GAGTCAGTGGACATGAGTACAGG + Intronic
1107840101 13:44449077-44449099 GAGTCAGGCAGCCTGGCTGCAGG + Intronic
1108159381 13:47622102-47622124 GAGTGAGTCAGCCTGGTTTCAGG - Intergenic
1109203713 13:59458869-59458891 GAGTCATTCATTCTGGCTACAGG + Intergenic
1112505815 13:99975031-99975053 AACTCAGCCAACCTGGGTTCTGG - Intergenic
1122249577 14:100428379-100428401 GAGTCAGGCGGCCTGGCTACGGG + Intronic
1122262755 14:100532479-100532501 AAGTCAGTCAATCTGAGTTCTGG - Intergenic
1122613698 14:103002566-103002588 GAGACAGTCCACCGGGGTCCTGG + Intronic
1124107495 15:26753735-26753757 GAGACAGTGAATGTGGGTACAGG + Intronic
1126655478 15:50972660-50972682 GAGTCAGCCAACTTGGGTTCTGG + Intronic
1131288715 15:91085858-91085880 GATTCAGGGAACCTGGGTTCTGG - Intergenic
1131540155 15:93268984-93269006 GAGTCAGTAGGCCTGGGTCCTGG - Intergenic
1131541775 15:93280587-93280609 GAGGCAGGCACTCTGGGTACAGG - Intergenic
1137237300 16:46626308-46626330 GAGCCAGCCCTCCTGGGTACCGG - Intergenic
1139216707 16:65132674-65132696 GAGTCAGGAAACTTGGGTTCTGG + Intergenic
1144449947 17:15368498-15368520 GAGTCAGAGTACCTGGGTTCGGG - Intergenic
1145411502 17:22669898-22669920 GAGTCATCCCACCTGGGCACCGG - Intergenic
1148505508 17:48123999-48124021 GAATCAGTCATCCTGGGTAATGG - Intergenic
1148871692 17:50662232-50662254 GTGCCAGGCAACCTGGGTGCTGG + Intronic
1148999107 17:51738879-51738901 GAGTCAGGAAACTTGGGTTCTGG + Intronic
1149077401 17:52612502-52612524 GAGTCATTCCACCTTGGTAATGG + Intergenic
1151148608 17:72064566-72064588 GTGTCAGTACACCTGGGCACTGG + Intergenic
1154209870 18:12370085-12370107 AAGTCAGTCAAAATGGGCACAGG + Intronic
1156866602 18:41895660-41895682 GAGTCATGGATCCTGGGTACAGG - Intergenic
1159985543 18:74836562-74836584 GAGTCAGTTACACTGGGCACAGG - Intronic
1164181343 19:22821536-22821558 AAGTCACATAACCTGGGTACTGG - Intergenic
1164227248 19:23256626-23256648 GAGTCACATAACATGGGTACAGG + Intergenic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
926807643 2:16726046-16726068 GAGTCAAACTACCTAGGTACTGG - Intergenic
927494271 2:23542089-23542111 GAGTCAGGCAACCAGGGTGGTGG + Intronic
927929632 2:27035867-27035889 GAGTCAGTGGACCTGGGGCCTGG + Intronic
929363516 2:41123716-41123738 GAGTCAGTCAACTTGTGTTATGG - Intergenic
931398141 2:61906072-61906094 GTGTCAGTCTACCGGGGGACTGG - Intronic
931847542 2:66220121-66220143 GAGTCAGTCAAAATGAGTCCAGG - Intergenic
933171925 2:79134269-79134291 GAGTCAGTCAATAGGGGTCCAGG - Intergenic
937240815 2:120461257-120461279 GAGTCAGGCCACCTGGCTCCTGG - Intergenic
946591285 2:221250834-221250856 GAGTCCATCAACCTGGAAACAGG - Intergenic
948983521 2:241507234-241507256 GGGTCAGCCAACCTGGGGCCTGG - Intronic
1172689440 20:36780083-36780105 GAGTCAGGAAACCTGGGTTCTGG + Exonic
1172809223 20:37635162-37635184 CAGTCAGAGAACCTGGGTAAAGG + Intergenic
1174201851 20:48811909-48811931 GAGTCAGAAAACCTGGGTTTCGG + Intronic
1174362337 20:50036892-50036914 GAGTCAGCCAGACTGGGTTCAGG + Intergenic
1174507848 20:51028225-51028247 GAGTCAGGGGACCTGGGTTCTGG + Intergenic
1175071284 20:56336079-56336101 GAGTCAGCCACCCTGGGGAAGGG + Intergenic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
1176880728 21:14189433-14189455 ATGTCAGTCAAGCTGAGTACTGG + Intronic
952449329 3:33416334-33416356 AAGTCAGTCATCCTAGGTATAGG - Intronic
952577973 3:34797556-34797578 CAGTCAGACAACCTGGGCAAGGG - Intergenic
954460313 3:50622932-50622954 GAGTGAGGCATCCAGGGTACTGG - Intronic
958882757 3:99691574-99691596 GAGTTAGCAAACCTGTGTACTGG - Intronic
959199658 3:103230280-103230302 GAGTAAGTCTATCAGGGTACAGG - Intergenic
961139973 3:124547605-124547627 GAGACAGTCACTCTGGGTACAGG - Intronic
961750419 3:129091000-129091022 GAGCCAGCCCTCCTGGGTACCGG - Exonic
962400853 3:135057544-135057566 GAGTCAGGCAGTCTGGGTTCTGG + Intronic
966418934 3:179718513-179718535 GAGTTAGACTACCTGGGTTCTGG + Intronic
967203211 3:187094053-187094075 GAATCAGTGAACCTGAATACAGG - Intergenic
967224783 3:187281029-187281051 GAGTCAGGCAGCCTGGGTCCTGG - Intronic
967417227 3:189232684-189232706 AAGTCAGGAAACCTGGGAACAGG + Intronic
972448314 4:39168815-39168837 GAGTATGTCAACCTTTGTACAGG + Intergenic
979154429 4:117365233-117365255 GAGGCAGTCAACTTTGCTACTGG + Intergenic
983672063 4:170248783-170248805 GAGTCAGGAAACCTGAGTCCTGG - Intergenic
989199003 5:38744615-38744637 GAGTCAGCCAGCCTGAGTTCAGG - Intergenic
990118268 5:52415839-52415861 TAGTCAGACCACATGGGTACAGG - Intergenic
994085355 5:95752468-95752490 GATTCAGTCAACCTGGGATAAGG + Intronic
994988282 5:106965872-106965894 GAGTCAGCCAAACTTGGTACTGG + Intergenic
996091840 5:119359057-119359079 GAGTCTGTCAGTCTGGGAACAGG - Intronic
996783855 5:127217108-127217130 GAGTCAGTCAACTAGGGCAGTGG + Intergenic
998019097 5:138754382-138754404 GAGGGAGTCAACCTTGGAACTGG - Intronic
998168031 5:139855645-139855667 CAGTCACTCAAGCTGGGGACAGG - Intronic
999125693 5:149244346-149244368 GAGTCAGCAAACCTGGGTTCTGG - Intronic
999983352 5:156978760-156978782 AATTCTGTTAACCTGGGTACTGG + Intergenic
1000357897 5:160418700-160418722 CAGTCTGTCAATTTGGGTACTGG + Intronic
1001001905 5:168015398-168015420 GAGTCTGGCTACCCGGGTACTGG - Intronic
1005753864 6:28908330-28908352 GAGTCAGGCTGCCTGGGTTCTGG - Intronic
1007962293 6:45970738-45970760 AAGTCAGACAACCTGCATACTGG + Intronic
1008003317 6:46383926-46383948 GAGTCAGTAATCCCTGGTACAGG - Intronic
1010760208 6:79714096-79714118 GGGTCAGGAAACCTGGGTTCTGG + Intergenic
1014931785 6:127344529-127344551 GAGGCAGTCGCCCTGGGCACAGG + Intergenic
1015576749 6:134679863-134679885 TTGTCACTCAACCTTGGTACAGG - Intergenic
1017564792 6:155671910-155671932 GGGTCAGGCTACCTGTGTACAGG + Intergenic
1021634274 7:22675979-22676001 GAGTCAGCCAGCCTGGGTTTAGG - Intergenic
1025784680 7:64633701-64633723 GAGTCACACAACCTGGGTGTGGG - Intergenic
1025784854 7:64634996-64635018 GAGTCAAATAACCTGGGTACTGG - Intergenic
1025786916 7:64652134-64652156 GAGTAAGTTTACCTGGGTGCTGG - Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1030984778 7:116228917-116228939 GAGTCAGGAAACCTGTGTTCTGG - Intronic
1032242025 7:130169786-130169808 GAGTCGGAAAACCTGGGTTCTGG - Intronic
1032748766 7:134814826-134814848 GAGTCAAGAAACCTGGGTATTGG + Intronic
1035054263 7:156023415-156023437 GATTCAGAAAACCTGGGTTCAGG - Intergenic
1035061519 7:156073008-156073030 GAGTCAGCCAGCCTGGCTGCTGG + Intergenic
1038238450 8:25784939-25784961 GAATCATTCCACCTGGGAACTGG - Intergenic
1040358960 8:46646639-46646661 AAGTCACTCTACCTGGGTGCTGG - Intergenic
1040378326 8:46848014-46848036 GAGTCACTCCACCTAGGTGCTGG - Intergenic
1040387550 8:46923793-46923815 GAGCCAGGCCACCTGGGTTCTGG + Intergenic
1041973580 8:63771590-63771612 GAGTCAGGCAACCTGGGTTATGG + Intergenic
1044219387 8:89650820-89650842 GGGTCAGCCAACTTGGGTTCTGG - Intergenic
1048487185 8:134859264-134859286 GAGTCAGTAGAACTGGGTTCCGG + Intergenic
1049625249 8:143617025-143617047 GAGGCAGACAACCTTGGGACGGG + Intronic
1056137272 9:83642689-83642711 GAGGCAGTCATCCTGGGGTCAGG - Intronic
1059738298 9:117124186-117124208 GAGTCAGTAAACCAGGGTTGGGG + Intronic
1059781408 9:117531844-117531866 GAGTCAGGAGACCTGGGTTCAGG + Intergenic
1060420760 9:123468045-123468067 GGGACAGTCCACCTGGGTACAGG - Intronic
1062359975 9:136183052-136183074 GAGCAAGTCATCCTGGGCACAGG - Intergenic
1186787270 X:12965311-12965333 GAGTGAGTGACCCTGGGGACTGG - Intergenic
1189037764 X:37509742-37509764 GACTCAGGCAACCTGGGTTTGGG - Intronic
1192797451 X:74435822-74435844 GAGTCAGGAGACCTGGGTTCTGG + Intronic
1198019516 X:132644471-132644493 GAGTTAGGAAACCTGGGTTCTGG - Intronic
1200691288 Y:6307707-6307729 AACTCAGTCATCCTGGTTACCGG + Intergenic
1200859437 Y:7974719-7974741 GAGTCACACAACCTGAGTACTGG + Intergenic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic
1200902302 Y:8444982-8445004 GAGTCAAACAACCTGAGTTCTGG + Intergenic
1200958183 Y:8972066-8972088 GAAACAGTCATCCAGGGTACTGG - Intergenic
1200986111 Y:9304550-9304572 AACTCAGTCATCCGGGGTACCGG + Intergenic
1201043984 Y:9867009-9867031 AACTCAGTCATCCTGGTTACCGG - Intergenic
1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202259834 Y:22958891-22958913 GAGTCACACAACCTAAGTACGGG - Intergenic
1202264460 Y:23003367-23003389 GAGCCATATAACCTGGGTACTGG - Intronic
1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202412820 Y:24592635-24592657 GAGTCACACAACCTAAGTACGGG - Intergenic
1202417451 Y:24637109-24637131 GAGCCATATAACCTGGGTACTGG - Intronic
1202453335 Y:25032977-25032999 GAGCCATATAACCTGGGTACTGG + Intronic
1202457961 Y:25077435-25077457 GAGTCACACAACCTAAGTACGGG + Intergenic
1202465578 Y:25151318-25151340 GAGTCACTTCACCTGGCTACTGG - Intergenic