ID: 903142020

View in Genome Browser
Species Human (GRCh38)
Location 1:21344782-21344804
Sequence TCGGTGCTGTCAGAGACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903142020_903142025 11 Left 903142020 1:21344782-21344804 CCCCTGGTCTCTGACAGCACCGA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 903142025 1:21344816-21344838 CGCCACCACATACACCCCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 90
903142020_903142028 21 Left 903142020 1:21344782-21344804 CCCCTGGTCTCTGACAGCACCGA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 903142028 1:21344826-21344848 TACACCCCTTAGGCCACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903142020 Original CRISPR TCGGTGCTGTCAGAGACCAG GGG (reversed) Intronic
900907329 1:5568745-5568767 TGGGTATTGCCAGAGACCAGAGG + Intergenic
901736574 1:11316383-11316405 GCTGTGGTGTCAGAGGCCAGTGG + Intergenic
903142020 1:21344782-21344804 TCGGTGCTGTCAGAGACCAGGGG - Intronic
903698788 1:25230773-25230795 TGGGTACTGTCAGAAAGCAGGGG + Intronic
905849510 1:41263073-41263095 CAGGTGCTGTCAGGGAGCAGTGG + Intergenic
911101842 1:94101584-94101606 AGGGTGCTGTCTGAGTCCAGAGG - Intronic
913610968 1:120509542-120509564 TGGCTGCTGTGAGACACCAGAGG - Intergenic
914580220 1:149012697-149012719 TGGCTGCTGTGAGACACCAGTGG + Exonic
922754458 1:228087725-228087747 TCAGTGATGTCAGACACAAGAGG - Intronic
923086902 1:230709068-230709090 TCGGGGCTCTCAGAGGACAGAGG - Intronic
923148667 1:231215302-231215324 GCGGTGCTGTCAGAGCCCTCAGG + Intronic
923225716 1:231937390-231937412 TTAGTGCTTTCAGAGATCAGGGG + Intronic
1062910508 10:1208929-1208951 TCGGTGCTGTCAGGGCACTGAGG + Intronic
1065506103 10:26431736-26431758 TGTGTGCTGACATAGACCAGGGG - Intergenic
1068117112 10:52747509-52747531 TGGGTGCTGTCAGGAAGCAGGGG + Intergenic
1069175685 10:65286079-65286101 TCGGAGCTGTCCAAGACCATGGG - Intergenic
1072916196 10:99538683-99538705 GAGGTGCTGACAGAGCCCAGAGG - Intergenic
1075676869 10:124301926-124301948 TCAGTGCTGGCAGATTCCAGGGG + Intergenic
1076634145 10:131871950-131871972 TCCCTGCTGTCTCAGACCAGTGG + Intergenic
1077066427 11:642935-642957 TTGGTGCTGCCAGTGAGCAGTGG - Intergenic
1078360438 11:10663601-10663623 ACAGTGCTGTCATAGACCAGAGG - Intronic
1079430461 11:20384748-20384770 TAGCTGCTTTCAGAGCCCAGAGG - Intergenic
1083439165 11:62664881-62664903 TCGGGGCTGTGATAGACCAAGGG - Exonic
1084880790 11:72170068-72170090 GCGGAGCTGCCAGAGACCATGGG + Intergenic
1087014352 11:93542200-93542222 TTGGTGCTTTCAGAAACAAGTGG - Intronic
1090203655 11:124873190-124873212 TAGGTGCTCTGAGAGAACAGAGG - Intronic
1092731298 12:11537737-11537759 TCACTGATGTCACAGACCAGAGG - Intergenic
1096650303 12:53059154-53059176 TCGCTGCTGACAGAGAGCATGGG - Exonic
1097469062 12:59966128-59966150 ACTGTCCTGTCAGAAACCAGAGG - Intergenic
1098002156 12:65956357-65956379 TTGGTGATGTCAGAGGTCAGAGG - Intronic
1098142249 12:67462144-67462166 TGGTTGGTGCCAGAGACCAGAGG + Intergenic
1098477212 12:70919728-70919750 ACGGTGCTGAAAGAGACAAGAGG + Intronic
1103614282 12:122142307-122142329 TGGGTGCTGTCAGAGTTGAGGGG - Exonic
1104039733 12:125121995-125122017 GGAGTGCTGTCAGAGACCTGGGG + Intronic
1104921930 12:132295118-132295140 CCGGTGCTGCCACAGCCCAGGGG + Intronic
1107284226 13:38772273-38772295 TCTCTGCTGTCAAAGACCACAGG + Intronic
1110131967 13:72020935-72020957 TCTGTGCTGTCCCAGTCCAGGGG - Intergenic
1113239595 13:108322033-108322055 TAGAAACTGTCAGAGACCAGGGG - Intergenic
1113666607 13:112146174-112146196 TCTGTGTTCTCAGAGACAAGTGG - Intergenic
1116725422 14:48556581-48556603 TAGGGGCTGTCAGGGACTAGTGG + Intergenic
1119387114 14:74264415-74264437 CAAGTGCTGTCAGAGAACAGAGG - Intergenic
1119950009 14:78735406-78735428 TCTGTCCTGTCAGACTCCAGGGG - Intronic
1120022062 14:79541932-79541954 TAGATGCTGTCAGAAAGCAGAGG + Intronic
1120826794 14:88963352-88963374 CCAGTGCTTTCAGAGGCCAGAGG + Intergenic
1123415248 15:20090392-20090414 TCCCTGTTGTTAGAGACCAGAGG - Intergenic
1123524590 15:21097506-21097528 TCCCTGTTGTTAGAGACCAGAGG - Intergenic
1130512947 15:84604179-84604201 CCGGCGCTGGCTGAGACCAGAGG + Exonic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1134065686 16:11226505-11226527 CCGGTGTTGGCAGAGTCCAGAGG + Intergenic
1135863941 16:26083139-26083161 TATGTGCTGTCAGAGGGCAGAGG - Intronic
1140073685 16:71676379-71676401 TCAGTGCTTTCTGAGAACAGTGG - Intronic
1143563595 17:7708946-7708968 TCAGTGCTGTCAGAGAAGTGGGG + Intronic
1144783470 17:17819339-17819361 ACAGTGGTGCCAGAGACCAGGGG + Exonic
1146620714 17:34395001-34395023 ACTGTGATGTCAGAGTCCAGAGG + Intergenic
1150156631 17:62859201-62859223 TTGGTGCTGCCAGAGTTCAGGGG + Intergenic
1150212496 17:63448858-63448880 TGCTTTCTGTCAGAGACCAGGGG - Intergenic
1151731751 17:75915360-75915382 TTGGTGCTGTTGGAGACCTGAGG - Intronic
1152140780 17:78535129-78535151 TTTGTGCTGGCAGAGCCCAGGGG + Intronic
1152622044 17:81369852-81369874 TCTGGGGTGTCAGGGACCAGGGG - Intergenic
1152854108 17:82654150-82654172 TCGATGCTGTCAGGAAGCAGGGG - Intergenic
1155888199 18:31233996-31234018 TAGGTGCTGTCTGTGACCAGAGG + Intergenic
1156483072 18:37448308-37448330 TGGGTGCTGGCAGAGGACAGAGG + Intronic
1157478310 18:48037166-48037188 TCGGGAGGGTCAGAGACCAGTGG + Intronic
1159995005 18:74955872-74955894 TCTGTGCTGGCAGAGTCCACAGG + Intronic
1160459070 18:79023965-79023987 TCAGTGCTCGCAGAGAGCAGTGG + Intergenic
1160990011 19:1856667-1856689 TGGGAGCTGTCAGGGCCCAGTGG - Intronic
1161729414 19:5950069-5950091 CCTGTGCTCTCAAAGACCAGAGG + Intronic
930402876 2:50913007-50913029 TCGGTACTTTCAGTGACCAGTGG - Intronic
931542903 2:63349801-63349823 GCAGTGCTGTAAGAAACCAGGGG - Intronic
931756787 2:65381848-65381870 TGGGGGCTTTCAGACACCAGTGG + Intronic
933064114 2:77772745-77772767 GCGGAGCTGTCCAAGACCAGGGG - Intergenic
933420933 2:82044007-82044029 CTGGTGCTGGCAGAGAGCAGGGG - Intergenic
933561346 2:83889771-83889793 TGGATGCTGTCAGAAAGCAGGGG + Intergenic
935237893 2:101152999-101153021 TTGGGGCTGTCAGCCACCAGAGG - Intronic
935271069 2:101434998-101435020 CTGGTGATGTCAGACACCAGTGG - Intronic
936399216 2:112153268-112153290 TCGGTCCTTTCAGAGACCTAAGG + Intronic
937392585 2:121503529-121503551 TCAGTAATGTCAGAGAGCAGGGG - Intronic
948698779 2:239747755-239747777 TCAGGGCTCTCAGAGACAAGGGG + Intergenic
948979240 2:241484587-241484609 CAGGTGCTGACAGAGACCACAGG - Intronic
1170005238 20:11661515-11661537 TGGGTCCTGTCAGAGGGCAGAGG - Intergenic
1170893364 20:20394288-20394310 TCAGTACTTTCAGAGTCCAGGGG + Intronic
1171501322 20:25595665-25595687 TCGAAACTGTCACAGACCAGAGG - Intergenic
1173760740 20:45558155-45558177 TGGGTGCTGTCAGAAAGCGGGGG - Intronic
1173865535 20:46310022-46310044 TTCATGCTTTCAGAGACCAGAGG + Intergenic
1178490596 21:33048690-33048712 TGGGTGCAGTCAGATAACAGAGG - Intergenic
1178944653 21:36936815-36936837 ACAGTGCTCTCAGAGACCCGTGG - Exonic
1179060762 21:37976801-37976823 TCGGGGCAGGCAGAGTCCAGGGG + Intronic
1181040180 22:20188366-20188388 CAGGGGCTGTCAGAGCCCAGGGG + Intergenic
1182160992 22:28121440-28121462 TCGTTGCTGTAAGTGATCAGAGG - Intronic
1182712675 22:32332422-32332444 TCGGAGTTGGAAGAGACCAGGGG - Intergenic
1182892735 22:33832477-33832499 TCAGTGCTGTCAGTGACCAAGGG + Intronic
1183093209 22:35537635-35537657 TTGGTGCTGTGGGAGCCCAGAGG + Intergenic
1183176141 22:36226051-36226073 TCGGTGCTCTTCCAGACCAGGGG - Intergenic
1183182185 22:36267661-36267683 TCGGTGCTCTTCCAGACCAGGGG + Intergenic
1184399919 22:44267804-44267826 TCGGAGTTGGAAGAGACCAGGGG - Intronic
950025989 3:9820279-9820301 TAGGTGCTGTCAGAGGCCTTGGG + Intronic
950257929 3:11521272-11521294 TAGATGCTGACAAAGACCAGGGG + Intronic
953196407 3:40738410-40738432 TCTGTGGGGGCAGAGACCAGAGG - Intergenic
955673610 3:61427768-61427790 CCCGTGCTGTCAGAGAAAAGGGG - Intergenic
964862598 3:161219302-161219324 TGGATGCTGTCAGAAAGCAGGGG - Intronic
967575295 3:191082895-191082917 TCGGGCCTGTAAGAGAGCAGGGG + Intergenic
967755857 3:193167807-193167829 TAGATGCTGTCAGGGACCACTGG - Intergenic
968451306 4:677283-677305 TTGGTGGTGTCAGACATCAGAGG - Intronic
972224597 4:36997795-36997817 TGGGTGCTATCAGAGAAGAGAGG + Intergenic
973896363 4:55417633-55417655 TTGTTGCTGTGTGAGACCAGTGG + Intronic
975266969 4:72381301-72381323 TCAGTTCTACCAGAGACCAGTGG - Intronic
976146261 4:82044690-82044712 TCGCTGCTGCCAGATGCCAGTGG + Intergenic
979201661 4:117986097-117986119 TCTGTGATGTCAGACACAAGAGG - Intergenic
983207918 4:164930648-164930670 TCGATGATGTTGGAGACCAGGGG - Intergenic
987277600 5:16378071-16378093 TCAGTGCAGTCACAGCCCAGAGG - Intergenic
987428354 5:17799578-17799600 TGGATGCTGTCAGAAAGCAGGGG + Intergenic
987630111 5:20459433-20459455 TCCCTTCTGTCAGAGAGCAGGGG - Intronic
987856311 5:23424315-23424337 TCTGTGCTGTCCGAATCCAGGGG - Intergenic
988492697 5:31718103-31718125 TTGGTGCTGTAAAAGAGCAGAGG + Intronic
992412897 5:76524410-76524432 TGGGTGCTGTTGGAGAACAGTGG - Intronic
994075274 5:95643248-95643270 TAGGTGCTTACAGAGTCCAGTGG - Intergenic
999686440 5:154107534-154107556 TCTGTGCTGTCACCAACCAGTGG - Intronic
1000810797 5:165858323-165858345 CAGGTGCTGTGAGAGACCACTGG + Intergenic
1004276504 6:14241085-14241107 TCGGTGCTGTTACAAAGCAGAGG - Intergenic
1004328332 6:14698141-14698163 TCGGTGCTGGCTGGGAGCAGTGG + Intergenic
1013717515 6:112979984-112980006 TCCGTGTTCTCAGAGAACAGAGG + Intergenic
1018214654 6:161514926-161514948 TCAGTGCTGCTTGAGACCAGGGG - Intronic
1019455406 7:1124281-1124303 GGGGTGCTGCCAGTGACCAGCGG + Intronic
1021985380 7:26093155-26093177 GAGGAGCTGTCAGAGCCCAGGGG + Intergenic
1023606072 7:41932309-41932331 TGGGTGCTGTCAGAAAACAAGGG - Intergenic
1031987874 7:128175151-128175173 TGGGTGCTGCCAGGCACCAGTGG + Intergenic
1033628199 7:143131707-143131729 TCTCTGCTTTCAGAGACCAGGGG + Intergenic
1033721148 7:144060563-144060585 TCAGAGCTGTCTGAGACCATGGG + Intergenic
1034864065 7:154625633-154625655 TCAGTGCTATGAGGGACCAGGGG + Intronic
1034936774 7:155204944-155204966 TCGGGGATGTCAGGGTCCAGGGG - Intergenic
1034944058 7:155250631-155250653 TGGGAGCTGTCAGAGCCCAAGGG + Intergenic
1036023831 8:4880441-4880463 TCGGTGATGTCTGAGAAGAGAGG + Intronic
1038266401 8:26042464-26042486 TTGGTGGTGTCAGAGACCCCAGG - Intronic
1038852818 8:31296590-31296612 TCAGGGCTGCCAGAGAACAGTGG + Intergenic
1038930514 8:32188671-32188693 TCGCTGGTATCAGAGACAAGAGG + Intronic
1046041491 8:108911416-108911438 ACGGTGCTGTCAGGGCTCAGTGG - Intergenic
1047346109 8:124030543-124030565 TAGATGCTCTCAGAGCCCAGAGG + Intronic
1049446916 8:142635428-142635450 CTGATGCTGTCAGAGACCTGTGG + Intergenic
1049995066 9:1026850-1026872 GTGCTGCTGTCAGAGGCCAGTGG + Intergenic
1051690288 9:19705408-19705430 TTGGGGCTGTGATAGACCAGGGG + Intronic
1052996287 9:34553160-34553182 TAGGGGCTGTGAGAGAGCAGGGG - Intronic
1053369571 9:37549269-37549291 TGGGTGCTGTGGGAGCCCAGGGG - Intronic
1054973929 9:71120971-71120993 CCCGTGGTGTCAGAGACAAGAGG - Intronic
1057888377 9:98848739-98848761 TCGGTCCTGTGAGAGGCAAGCGG + Intronic
1061215487 9:129219345-129219367 TCAGTGCTCTCAGATTCCAGAGG + Intergenic
1061355746 9:130103620-130103642 ACTGTGTTTTCAGAGACCAGAGG - Intronic
1062081164 9:134624274-134624296 TCAGTGCTGCCTGAGACCAGGGG - Intergenic
1185788806 X:2912863-2912885 TCAGTGCTTTCAATGACCAGTGG - Intronic
1188259115 X:28001604-28001626 TGGGTGCTGTCAGAAATCTGAGG + Intergenic
1189198631 X:39173028-39173050 TCGGTGCTGTCAGTAATCGGAGG - Intergenic
1195916628 X:109942442-109942464 TCGGTGATGTCAGATAACAAGGG - Intergenic
1196651163 X:118169701-118169723 TCAGTGCTCTCAGAGATCAGAGG + Intergenic
1197272927 X:124445555-124445577 TGGGTGCTGTTGGAAACCAGTGG + Intronic
1197891799 X:131276577-131276599 GCTGGGCTGTCAGAGACCGGTGG - Intronic
1199656374 X:149998954-149998976 TTGATGCTGTCAGAGACAACAGG - Intergenic
1200234601 X:154462206-154462228 TCGGTGCTGTCGGCCAGCAGGGG - Exonic
1201286127 Y:12380235-12380257 TCAGTGCTTTCAATGACCAGTGG + Intergenic