ID: 903155508

View in Genome Browser
Species Human (GRCh38)
Location 1:21440045-21440067
Sequence GCCCCGCCGCGCCTGCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903155502_903155508 13 Left 903155502 1:21440009-21440031 CCTGTTGTGCAGTAGAGGCCGCC No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155504_903155508 -5 Left 903155504 1:21440027-21440049 CCGCCGAGTCCCTTTAAGGCCCC No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155499_903155508 28 Left 903155499 1:21439994-21440016 CCTAACCTGCTCGAACCTGTTGT No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155498_903155508 29 Left 903155498 1:21439993-21440015 CCCTAACCTGCTCGAACCTGTTG No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155500_903155508 23 Left 903155500 1:21439999-21440021 CCTGCTCGAACCTGTTGTGCAGT No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155505_903155508 -8 Left 903155505 1:21440030-21440052 CCGAGTCCCTTTAAGGCCCCGCC No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data
903155497_903155508 30 Left 903155497 1:21439992-21440014 CCCCTAACCTGCTCGAACCTGTT No data
Right 903155508 1:21440045-21440067 GCCCCGCCGCGCCTGCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903155508 Original CRISPR GCCCCGCCGCGCCTGCGCCT TGG Intergenic