ID: 903156915

View in Genome Browser
Species Human (GRCh38)
Location 1:21451667-21451689
Sequence AACAGGGCATAGTGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903156904_903156915 25 Left 903156904 1:21451619-21451641 CCTGTGACCAGCATGAGCTTCTG 0: 3
1: 1
2: 8
3: 22
4: 168
Right 903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 122
903156909_903156915 -3 Left 903156909 1:21451647-21451669 CCACAAAGGGCACTCAAGTGAAC 0: 1
1: 9
2: 0
3: 12
4: 120
Right 903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 122
903156906_903156915 18 Left 903156906 1:21451626-21451648 CCAGCATGAGCTTCTGTCAGGCC 0: 2
1: 2
2: 7
3: 14
4: 161
Right 903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903156915 Original CRISPR AACAGGGCATAGTGGGTCCT GGG Intronic
900531867 1:3157867-3157889 AAGATGGCATAGTTGGTGCTGGG - Intronic
901205436 1:7492293-7492315 AGCAGGGCAGAGCAGGTCCTGGG - Intronic
901615961 1:10539956-10539978 AACCCTGCATAGTGGGGCCTGGG + Intronic
902464185 1:16605011-16605033 AACAGGGCATATGGGGTCCTGGG - Intronic
903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG + Intronic
904626936 1:31811694-31811716 GACAGGGCTGAGTGGGGCCTGGG - Intronic
904919433 1:33995398-33995420 AACAGGGCCTAGTGGCTTCAGGG + Intronic
904929394 1:34074361-34074383 AGCAGGGCATACAGGGTCCCTGG + Intronic
905612156 1:39363089-39363111 CACAGTACATAGTGGGTCATAGG - Intronic
906097766 1:43235849-43235871 GACAGGGCACAGAGGGTGCTAGG - Intronic
908408707 1:63841974-63841996 AATGAGGCATAGTGGGTGCTGGG - Intronic
909698548 1:78493927-78493949 AACAGGGCATATTAGCTACTGGG + Intronic
912965778 1:114236012-114236034 AACAGGGCACAGTTGGCACTTGG - Intergenic
913992696 1:143629409-143629431 AACAGGGCATAGGGGGCCCTGGG - Intergenic
915538673 1:156553515-156553537 AATAGGGCAAAGTGGGTAATGGG - Intronic
921055441 1:211539157-211539179 TACAGGGTATGGTGGGGCCTGGG + Intergenic
923007113 1:230058880-230058902 GACAGCCCATTGTGGGTCCTGGG + Intronic
1068803619 10:61170323-61170345 AACAGGGAGTAGTGGGAACTGGG - Intergenic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1074307710 10:112294220-112294242 AACAGGACATAGTGCATTCTAGG + Intronic
1076700541 10:132270568-132270590 AAGAGGCCATGCTGGGTCCTGGG - Intronic
1077409389 11:2396393-2396415 AAAAGGGCACAGTGTGTCCCAGG + Intronic
1077487801 11:2847063-2847085 GACATGGCATAATGGTTCCTGGG + Intronic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1085076436 11:73597030-73597052 GAAAGGGCATGGTGGCTCCTTGG - Intronic
1085327641 11:75619172-75619194 CACAGGGTATGGTGTGTCCTAGG - Intronic
1087807644 11:102572328-102572350 AAAAGGACATACTGGGTCCAGGG - Intergenic
1088366141 11:109041808-109041830 AGAAGGGAAGAGTGGGTCCTGGG - Intergenic
1090879483 11:130821041-130821063 GACAGGCCATAGTAGGTCTTTGG + Intergenic
1091881579 12:3983133-3983155 AAAAGGGCATAGTGAGCTCTAGG + Intergenic
1091910560 12:4227189-4227211 GACAGTGCATAGTGGGGCCTGGG - Intergenic
1094029073 12:25990036-25990058 AACTGGGCAGAGTGGTGCCTGGG + Intronic
1094595777 12:31865158-31865180 AAAAGGTCACAGTGGGACCTTGG + Intergenic
1095951174 12:47782797-47782819 CACAGGGTATGGTGGGTCCTAGG + Exonic
1098307112 12:69113469-69113491 AACAGGGCACAGTGGGTGGAAGG - Intergenic
1098575866 12:72041708-72041730 TACAGGGCATAGTGGTTGGTGGG + Intronic
1104038324 12:125113884-125113906 AATAGGGCATAGTGGGTGGGAGG + Intronic
1104590687 12:130082211-130082233 AACAGGGCATTCTGGCTCCATGG + Intergenic
1108176553 13:47798479-47798501 CACAAGTCAAAGTGGGTCCTGGG + Intergenic
1113638855 13:111943176-111943198 AACAGGGCCCAGAGGGTGCTCGG + Intergenic
1114706839 14:24736274-24736296 AACAGAGGATAGTGGAGCCTGGG - Intergenic
1115060615 14:29184797-29184819 AACAGGGAATTGTGGGTCCATGG + Intergenic
1118660265 14:68001712-68001734 AACAATACATAGTGGGGCCTTGG - Intronic
1120737417 14:88068590-88068612 AACAGGGAAAAGTAGGTCTTAGG + Intergenic
1122169660 14:99861867-99861889 AACAGGGGAAACTGGGTACTGGG - Intronic
1122889895 14:104727398-104727420 AAGATGGCATAGTGGGGCCAGGG - Intronic
1123431988 15:20225888-20225910 ATCAGGGTATCTTGGGTCCTAGG - Intergenic
1126251274 15:46571071-46571093 AACAGCCCATGGTGGGTTCTTGG - Intergenic
1127998772 15:64171749-64171771 GCCAGGGCCTAGTGGGTCATTGG - Exonic
1129795695 15:78374508-78374530 ATGAGAGCATAGTGGGACCTGGG - Intergenic
1130668088 15:85886569-85886591 GAGAGGGCAAAGTGGGCCCTGGG - Intergenic
1131588465 15:93721551-93721573 GACAGGGCAGAGTCTGTCCTTGG + Intergenic
1132131239 15:99282076-99282098 AACAGGATACAGTGGGTCATGGG - Intronic
1134467526 16:14492537-14492559 AACAGGGCAGAGTGTGATCTTGG + Intronic
1136852650 16:33625251-33625273 ATCAGGGTATCTTGGGTCCTAGG + Intergenic
1138343609 16:56306860-56306882 AAAAGGGCAGCGTGGGGCCTCGG + Intronic
1141948479 16:87325678-87325700 AGCAGGGGATCGTGGGTCCCCGG - Intronic
1141948496 16:87325727-87325749 AGCAGGGGATCGTGGGTCCCCGG - Intronic
1203114254 16_KI270728v1_random:1473719-1473741 ATCAGGGTATCTTGGGTCCTAGG + Intergenic
1143857354 17:9862063-9862085 CACAGAGCATCATGGGTCCTCGG - Exonic
1147156571 17:38547176-38547198 AAGAGGGCATCGTAGGCCCTTGG + Intronic
1148593050 17:48831025-48831047 AACAGGGCAGAGTGGGACGGGGG - Exonic
1148819222 17:50350891-50350913 CACAGGGGATAGTGGGTGCAAGG + Intronic
1153347150 18:4039258-4039280 TACAGAGGATAGTGGGGCCTGGG - Intronic
1155414334 18:25581325-25581347 AACAGGGCACAGTGGCAACTTGG + Intergenic
1157738526 18:50072051-50072073 AACAGGGCCTAGTGGTACCAAGG - Intronic
1161534722 19:4811956-4811978 AGCAGGGCCTGGTGGGTCATGGG - Intergenic
1161907279 19:7166240-7166262 AAGATGGCATACTGGGTCCAGGG + Exonic
1161954705 19:7486919-7486941 AACAGGGCATGGTGGTTACTTGG + Intronic
1162032369 19:7923033-7923055 AACAAGGCACAGTGGGGCTTGGG - Exonic
1163020371 19:14478193-14478215 AACAGGGCACAGGGGGGCCGGGG + Exonic
1168277946 19:55287371-55287393 AACAGGGCCTAGGGGGACCTGGG + Intronic
927015915 2:18961615-18961637 AACAGGGAAGAATGAGTCCTGGG + Intergenic
928213025 2:29337822-29337844 AACTGAACAAAGTGGGTCCTTGG - Intronic
931257379 2:60585190-60585212 AGCAAGGCAGAGTGGGTCGTGGG + Intergenic
931384034 2:61780501-61780523 AACAGTGCATATTGTGTCATGGG - Intergenic
936987062 2:118321638-118321660 GGAAGGGCAGAGTGGGTCCTAGG - Intergenic
937256296 2:120558127-120558149 AAGAGGGCATAGAGGGACCTAGG - Intergenic
938140530 2:128791281-128791303 AGCAGGGCAGAGTGGGAGCTGGG - Intergenic
939939345 2:148330134-148330156 AAAAGGGTATGGTGGGTCATAGG + Intronic
944864777 2:203849657-203849679 AACAGGGAATAATATGTCCTTGG + Intergenic
947750713 2:232530599-232530621 AGCAGGGCATAGTGAGTCCCAGG + Intronic
1168815733 20:735528-735550 AACAAGGCATGGTGGTTGCTAGG - Intergenic
1172151237 20:32792079-32792101 AACAGGGTATAATGGTTCATAGG - Intronic
1173368639 20:42413974-42413996 AGCCGGGCATGGTGGCTCCTCGG - Intronic
1174121303 20:48267852-48267874 AACACAGTAAAGTGGGTCCTTGG - Intergenic
1182222675 22:28771399-28771421 AACAGGGCATAGTCAGTGATTGG + Intergenic
1182312086 22:29416364-29416386 AGGGGGGCATAGGGGGTCCTAGG + Intronic
1182688174 22:32136879-32136901 AGGGGGGCATAGGGGGTCCTAGG - Intergenic
1182973866 22:34603936-34603958 AATAGGACATAGTAGGTGCTTGG + Intergenic
1183279498 22:36924377-36924399 CACAGGGCAGAGTGGGGACTTGG - Intronic
950315246 3:11996236-11996258 AACAGGCCATAGTGAGCACTTGG - Intergenic
951621510 3:24606741-24606763 TTCAGGGCATGGTGGGACCTTGG + Intergenic
951821715 3:26821288-26821310 AAGTGGGCTTATTGGGTCCTAGG - Intergenic
953979884 3:47408311-47408333 AACAGGGCCAGGTGGGTGCTGGG - Intronic
954654906 3:52188427-52188449 AACAGGGCCTGGTGTGTCCAGGG - Intergenic
955798048 3:62658371-62658393 TAAAGGGCATAATGGATCCTTGG + Intronic
960739485 3:120817217-120817239 AACAGGGCAGAGCTGGTCCATGG + Intergenic
961050012 3:123737979-123738001 AACAGGGCAGTGAGGATCCTAGG - Intronic
968065035 3:195753842-195753864 AACCGGGCAAGCTGGGTCCTCGG - Intronic
977674393 4:99731957-99731979 AACTGGGCATGGTGGCTACTTGG + Intergenic
991049231 5:62254902-62254924 ATCAGGGTATCTTGGGTCCTAGG - Intergenic
992833587 5:80618804-80618826 AGCTGGGCATAGTGGCTGCTTGG + Intergenic
994208398 5:97061200-97061222 CACAGGGCATGCTGGGGCCTTGG + Intergenic
994489109 5:100419175-100419197 GACAGGGCAAAGGGAGTCCTTGG + Intergenic
998895061 5:146790171-146790193 AAAAGGGCACAGTGGGTCACTGG + Intronic
1000437503 5:161230977-161230999 ATCAGGGCAGAGTGGGGACTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1010000337 6:70942464-70942486 AACAGGGCCTAGTGGGTGATGGG - Intronic
1015238178 6:130994400-130994422 GGCAGGGCAGAGTGTGTCCTGGG + Intronic
1017610817 6:156184550-156184572 CATGGGGCAGAGTGGGTCCTGGG + Intergenic
1017760248 6:157562886-157562908 ACCTGGGCACAGTGGGTGCTTGG - Intronic
1018977857 6:168579144-168579166 AACAGGACACAGTGTGACCTGGG - Intronic
1019573699 7:1726115-1726137 CCCAGGGCCTAGTGGGTCTTCGG + Intronic
1023891258 7:44393442-44393464 AACAGGGCATGGTGTGGCCAGGG - Intronic
1027187693 7:75981750-75981772 AACGTGGCAGAGTGAGTCCTTGG - Intronic
1029513754 7:101013160-101013182 ACCAGGACAGAGTGGGTGCTGGG - Intronic
1035637674 8:1159056-1159078 AACAGAGCAGTGTGGCTCCTGGG - Intergenic
1043419186 8:80081950-80081972 AGCCGGGCATAGTGGGTGGTGGG - Intronic
1048958177 8:139554154-139554176 AACTGAGCATGGTGGGTACTAGG - Intergenic
1057485514 9:95479934-95479956 TACAGGGCATAGATTGTCCTCGG + Intronic
1058753209 9:108059724-108059746 AACAGGGGACAGCTGGTCCTAGG - Intergenic
1061371243 9:130198741-130198763 CACAGGGCACTGTGTGTCCTTGG - Intronic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1187146918 X:16645462-16645484 GACTGGGCATAGTGTGTACTCGG - Intronic
1189938561 X:46096564-46096586 AACATGGCAGAGTGAATCCTGGG - Intergenic
1190221874 X:48517076-48517098 CACAGGGCACAGTGGGTTCCAGG - Intronic
1190703033 X:53002296-53002318 AAAAGTTCATAGTGGGACCTGGG + Intergenic
1193669140 X:84362382-84362404 AACAGGGCACAGAGAGTCCATGG + Intronic
1200214295 X:154360611-154360633 ATCGGGGCATAGTGTGGCCTTGG - Intronic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic