ID: 903160976

View in Genome Browser
Species Human (GRCh38)
Location 1:21488981-21489003
Sequence TCCTCCCCAGGATGGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160976_903160981 0 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160981 1:21489004-21489026 ACTAGTTGCCTGGACCAGGATGG No data
903160976_903160980 -4 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160980 1:21489000-21489022 AGGAACTAGTTGCCTGGACCAGG No data
903160976_903160983 9 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data
903160976_903160985 17 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160985 1:21489021-21489043 GGATGGTAGTGATGGAGACGAGG No data
903160976_903160979 -10 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160979 1:21488994-21489016 CTGGGGAGGAACTAGTTGCCTGG No data
903160976_903160986 23 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160986 1:21489027-21489049 TAGTGATGGAGACGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160976 Original CRISPR TCCTCCCCAGGATGGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr