ID: 903160979

View in Genome Browser
Species Human (GRCh38)
Location 1:21488994-21489016
Sequence CTGGGGAGGAACTAGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160971_903160979 1 Left 903160971 1:21488970-21488992 CCACGGGGACGCCTTGCAGCCAT No data
Right 903160979 1:21488994-21489016 CTGGGGAGGAACTAGTTGCCTGG No data
903160970_903160979 8 Left 903160970 1:21488963-21488985 CCTGAGACCACGGGGACGCCTTG No data
Right 903160979 1:21488994-21489016 CTGGGGAGGAACTAGTTGCCTGG No data
903160976_903160979 -10 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160979 1:21488994-21489016 CTGGGGAGGAACTAGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160979 Original CRISPR CTGGGGAGGAACTAGTTGCC TGG Intergenic
No off target data available for this crispr