ID: 903160980

View in Genome Browser
Species Human (GRCh38)
Location 1:21489000-21489022
Sequence AGGAACTAGTTGCCTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160976_903160980 -4 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160980 1:21489000-21489022 AGGAACTAGTTGCCTGGACCAGG No data
903160971_903160980 7 Left 903160971 1:21488970-21488992 CCACGGGGACGCCTTGCAGCCAT No data
Right 903160980 1:21489000-21489022 AGGAACTAGTTGCCTGGACCAGG No data
903160970_903160980 14 Left 903160970 1:21488963-21488985 CCTGAGACCACGGGGACGCCTTG No data
Right 903160980 1:21489000-21489022 AGGAACTAGTTGCCTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160980 Original CRISPR AGGAACTAGTTGCCTGGACC AGG Intergenic
No off target data available for this crispr