ID: 903160983

View in Genome Browser
Species Human (GRCh38)
Location 1:21489013-21489035
Sequence CTGGACCAGGATGGTAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160978_903160983 -3 Left 903160978 1:21488993-21489015 CCTGGGGAGGAACTAGTTGCCTG No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data
903160971_903160983 20 Left 903160971 1:21488970-21488992 CCACGGGGACGCCTTGCAGCCAT No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data
903160977_903160983 1 Left 903160977 1:21488989-21489011 CCATCCTGGGGAGGAACTAGTTG No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data
903160976_903160983 9 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data
903160970_903160983 27 Left 903160970 1:21488963-21488985 CCTGAGACCACGGGGACGCCTTG No data
Right 903160983 1:21489013-21489035 CTGGACCAGGATGGTAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160983 Original CRISPR CTGGACCAGGATGGTAGTGA TGG Intergenic
No off target data available for this crispr