ID: 903160985

View in Genome Browser
Species Human (GRCh38)
Location 1:21489021-21489043
Sequence GGATGGTAGTGATGGAGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160971_903160985 28 Left 903160971 1:21488970-21488992 CCACGGGGACGCCTTGCAGCCAT No data
Right 903160985 1:21489021-21489043 GGATGGTAGTGATGGAGACGAGG No data
903160978_903160985 5 Left 903160978 1:21488993-21489015 CCTGGGGAGGAACTAGTTGCCTG No data
Right 903160985 1:21489021-21489043 GGATGGTAGTGATGGAGACGAGG No data
903160977_903160985 9 Left 903160977 1:21488989-21489011 CCATCCTGGGGAGGAACTAGTTG No data
Right 903160985 1:21489021-21489043 GGATGGTAGTGATGGAGACGAGG No data
903160976_903160985 17 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160985 1:21489021-21489043 GGATGGTAGTGATGGAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160985 Original CRISPR GGATGGTAGTGATGGAGACG AGG Intergenic
No off target data available for this crispr