ID: 903160986

View in Genome Browser
Species Human (GRCh38)
Location 1:21489027-21489049
Sequence TAGTGATGGAGACGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903160982_903160986 -8 Left 903160982 1:21489012-21489034 CCTGGACCAGGATGGTAGTGATG No data
Right 903160986 1:21489027-21489049 TAGTGATGGAGACGAGGAGATGG No data
903160978_903160986 11 Left 903160978 1:21488993-21489015 CCTGGGGAGGAACTAGTTGCCTG No data
Right 903160986 1:21489027-21489049 TAGTGATGGAGACGAGGAGATGG No data
903160976_903160986 23 Left 903160976 1:21488981-21489003 CCTTGCAGCCATCCTGGGGAGGA No data
Right 903160986 1:21489027-21489049 TAGTGATGGAGACGAGGAGATGG No data
903160977_903160986 15 Left 903160977 1:21488989-21489011 CCATCCTGGGGAGGAACTAGTTG No data
Right 903160986 1:21489027-21489049 TAGTGATGGAGACGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903160986 Original CRISPR TAGTGATGGAGACGAGGAGA TGG Intergenic
No off target data available for this crispr