ID: 903163251

View in Genome Browser
Species Human (GRCh38)
Location 1:21504008-21504030
Sequence GCTCAGAGCTGACTGCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903163244_903163251 13 Left 903163244 1:21503972-21503994 CCCGGGCCAGGGGCTGGCCGGCT No data
Right 903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG No data
903163245_903163251 12 Left 903163245 1:21503973-21503995 CCGGGCCAGGGGCTGGCCGGCTG No data
Right 903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG No data
903163249_903163251 -4 Left 903163249 1:21503989-21504011 CCGGCTGTTAGGGTACTGAGCTC No data
Right 903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG No data
903163246_903163251 7 Left 903163246 1:21503978-21504000 CCAGGGGCTGGCCGGCTGTTAGG No data
Right 903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903163251 Original CRISPR GCTCAGAGCTGACTGCTAGG AGG Intergenic
No off target data available for this crispr