ID: 903163912

View in Genome Browser
Species Human (GRCh38)
Location 1:21508225-21508247
Sequence GAACCAATTTTAGCCAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903163912_903163916 0 Left 903163912 1:21508225-21508247 CCTGACCTGGCTAAAATTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 221
Right 903163916 1:21508248-21508270 TCTGGGCAGACATTTTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 256
903163912_903163921 26 Left 903163912 1:21508225-21508247 CCTGACCTGGCTAAAATTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 221
Right 903163921 1:21508274-21508296 ACTGAGAAGACCCTCCTGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 141
903163912_903163917 1 Left 903163912 1:21508225-21508247 CCTGACCTGGCTAAAATTGGTTC 0: 1
1: 0
2: 0
3: 8
4: 221
Right 903163917 1:21508249-21508271 CTGGGCAGACATTTTCCCAAGGG 0: 1
1: 0
2: 1
3: 28
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903163912 Original CRISPR GAACCAATTTTAGCCAGGTC AGG (reversed) Intergenic
901065696 1:6493175-6493197 GGACCAATTTCAGGCAGGGCTGG - Intronic
902945723 1:19836219-19836241 AAAAAAATTTTAGCCAGGTGTGG + Intergenic
903163912 1:21508225-21508247 GAACCAATTTTAGCCAGGTCAGG - Intergenic
906450747 1:45945145-45945167 AAACAAAATTTAGCCAGGTGTGG + Intronic
906529896 1:46517738-46517760 TAACAAATATTAGCCAGGTGTGG + Intergenic
906847530 1:49209541-49209563 GAACAAAGTTTAGCCTAGTCTGG + Intronic
908221329 1:62009792-62009814 AAACCACTTTTGGCCAGGCCTGG + Intronic
908456160 1:64306950-64306972 GACTCAATTTTGGCCAGGTGTGG - Intergenic
909463413 1:75944842-75944864 AAACCTATTTAAGCCAGGTGTGG + Intergenic
910882545 1:91935260-91935282 AAACAAAAATTAGCCAGGTCTGG + Intergenic
911223378 1:95276714-95276736 GAACAAAAATTAGCCAGGTGTGG + Intergenic
913449180 1:118980986-118981008 ATACAAATTTTAGCCAGGTGTGG - Intronic
916175246 1:162032619-162032641 GTAACAATTTTAGCCTTGTCAGG + Intergenic
916394858 1:164374733-164374755 GAGCCCATTTTAGCCACATCTGG - Intergenic
916685819 1:167144746-167144768 TAAACAAATTTAGCCAGGTGTGG + Intergenic
917044578 1:170844241-170844263 AAAGCAATTTTAGCAAGCTCTGG + Intergenic
917947265 1:179987768-179987790 AAACAAAATTTAGCCAGGCCTGG + Intronic
918450882 1:184656855-184656877 GTACAAAATTTAGCCAGGCCTGG - Intergenic
919961183 1:202470747-202470769 AAAAAAATTTTAGCCAGGCCTGG + Intronic
921606385 1:217160490-217160512 AAACAAATATTAGCCAGGTGTGG - Intergenic
922478844 1:225924581-225924603 GAAATAATATTAGCCAGGCCTGG - Intergenic
922664855 1:227459949-227459971 AAAACAAATTTAGCCAGGTGGGG + Intergenic
923698004 1:236273648-236273670 GTACAAAAATTAGCCAGGTCTGG + Intronic
924857388 1:247887519-247887541 GAAACACTTTTGGCCAGGTGCGG - Intergenic
1062968894 10:1630797-1630819 GTACCAAAATTAGCCAGGTGTGG + Intronic
1064875454 10:19988949-19988971 GTACAAAATTTAGCCAGGTGTGG - Intronic
1065722805 10:28642856-28642878 ATACCAATATTAGCCAGGTGTGG + Intergenic
1066221943 10:33343802-33343824 GCACCACTGTTAGCCAGGTGAGG + Intergenic
1067327782 10:45286246-45286268 GACCAAATTTCAGCAAGGTCTGG + Intergenic
1068541122 10:58295973-58295995 GAAACATTTGTATCCAGGTCAGG - Intergenic
1070904152 10:80056975-80056997 AAACCAAAATTAGCCAGGTGTGG + Intergenic
1073701507 10:105932622-105932644 GAAAAAATATTAGCCAGGTGTGG + Intergenic
1076179457 10:128395632-128395654 GAACTAATTTTGGCCAGGCATGG - Intergenic
1079937852 11:26640161-26640183 GAAGGAATTTAAACCAGGTCTGG - Intronic
1082121402 11:48383807-48383829 GAACCATTTTAAACCATGTCAGG + Intergenic
1083696292 11:64444913-64444935 GAACCAGATTTAGCCAGGCAAGG - Intergenic
1088610032 11:111568093-111568115 GACCCAATTTTGGCCAGGCGTGG + Intergenic
1093215689 12:16358756-16358778 GAATGAATTTTGGCCAGGTCCGG - Intronic
1096373998 12:51092535-51092557 GGATCACTTTAAGCCAGGTCAGG - Intergenic
1096378655 12:51136151-51136173 AAAAAAATTTTAGCCAGGTGTGG + Intronic
1096383763 12:51180804-51180826 ATACAAATTTTAGCCAGGTGTGG + Intergenic
1096800142 12:54105193-54105215 GAACCGGTGTTAGCCAGGTGTGG + Intergenic
1097185306 12:57193437-57193459 GAACCACTGTTAGCCTGGACTGG + Intronic
1099125550 12:78752205-78752227 AAACAAATATTAGCCAGGTGTGG + Intergenic
1099287766 12:80736375-80736397 TAGTCAATTTTAGCCAGGTGTGG + Intergenic
1099686663 12:85898526-85898548 GAACCAACTGTGGCCAGGTGCGG + Intergenic
1100300688 12:93304902-93304924 GATTCAATTTTGGCCAGGTGTGG + Intergenic
1100385901 12:94104479-94104501 GTACCAGTTTTGGCCAGGTGCGG + Intergenic
1101744121 12:107525169-107525191 GAAACAAAATTAGCCAGGTGTGG + Intronic
1101853964 12:108426843-108426865 GAACCTATTGTAGCAAGGGCAGG + Intergenic
1102112964 12:110379012-110379034 GAAACAAATTTAGCCAGGCATGG - Intronic
1102296723 12:111742863-111742885 GTACAAAATTTAGCCAGGTGTGG - Intronic
1102313983 12:111871348-111871370 AAATCAACTTTAGCCAGGTGCGG + Intronic
1103370628 12:120416566-120416588 GTACCAAAATTAGCCAGGTGTGG + Intergenic
1105309547 13:19194168-19194190 AAACCAACGTTAGCCAGGTGTGG - Intergenic
1106962059 13:35010423-35010445 AAACAAATATTAGCCAGGTGTGG + Intronic
1107928314 13:45285697-45285719 AAAGCAATTTAAGCCAGGTGCGG - Intergenic
1109781370 13:67114346-67114368 GAACCAATTTTAGCCTCTTTGGG + Intronic
1110958751 13:81592993-81593015 GGACCAATTTTATACAGGACTGG - Intergenic
1114319129 14:21532483-21532505 AAAAAAATTTTAGCCAGGTGTGG + Intronic
1114716125 14:24826907-24826929 GTACCTATTTTGGCCAGGTGTGG + Intronic
1117597379 14:57337147-57337169 GATACAATTGTGGCCAGGTCAGG - Intergenic
1117939081 14:60941548-60941570 GAACAAAACTTAGCCAGGTATGG + Intronic
1122706432 14:103624974-103624996 GATCCCAGATTAGCCAGGTCCGG + Intronic
1124006039 15:25796247-25796269 GAAACAAAATTAGCCAGGTGTGG + Intronic
1124423989 15:29547376-29547398 GAATCAATGTGGGCCAGGTCTGG - Intronic
1126445023 15:48732820-48732842 GAGCCAAATGTGGCCAGGTCTGG + Intronic
1126757955 15:51942629-51942651 AAACAAATTTTGGCCAGGTGCGG + Intronic
1126811551 15:52410864-52410886 GAATCAGTTTTGGCCAGGTGTGG - Intronic
1127406031 15:58647414-58647436 GAAACAAAATTAGCCAGGTGTGG - Intronic
1127517152 15:59707013-59707035 AAACAAATATTAGCCAGGTGTGG - Intergenic
1127698472 15:61474199-61474221 GAACAGATTTTAGCAAGGTGGGG + Intergenic
1128558568 15:68648492-68648514 AAAACAAAATTAGCCAGGTCTGG + Intronic
1130231751 15:82102525-82102547 GAACCACTGTTAGGCAGATCAGG + Intergenic
1131253263 15:90844849-90844871 GAACCAGTTTTAGCCAGGCGTGG - Intergenic
1131670899 15:94618698-94618720 AAACGAAAATTAGCCAGGTCTGG - Intergenic
1133932645 16:10244781-10244803 GAAACAAAATTAGCCAGGTGCGG - Intergenic
1138741919 16:59320947-59320969 AACCCAAATGTAGCCAGGTCAGG - Intergenic
1139566159 16:67778057-67778079 GAACAAAGTTTGGCCAGGTGCGG + Intronic
1139707060 16:68748266-68748288 GAAACAAAGTTAGCCAGGTGTGG - Intronic
1139913016 16:70409791-70409813 AAAAAAAATTTAGCCAGGTCTGG - Intronic
1140070296 16:71643382-71643404 GAACCATTTCTGGCCAGGTGTGG + Intronic
1140751905 16:78032421-78032443 GTACCAAAATTAGCCAGGTGTGG + Intronic
1141480654 16:84304530-84304552 GAATCATTTTTATCCAGGTAAGG + Intronic
1143123292 17:4623758-4623780 GAACCAAAATTAGCCAGGCCTGG - Intergenic
1145100864 17:20075647-20075669 TAAAAAAATTTAGCCAGGTCTGG + Intronic
1146454458 17:32998071-32998093 GACCCAAATTTTGCCAGGTGTGG - Intergenic
1147589751 17:41674657-41674679 TAACAAAATTTAGCCAGGTGTGG + Intergenic
1147873968 17:43607713-43607735 AAAAAAATTTTAGCCAGGTGTGG - Intergenic
1149096180 17:52843619-52843641 GAACTGATATTATCCAGGTCTGG - Intergenic
1149999086 17:61421211-61421233 AAACCATATTTGGCCAGGTCAGG + Intergenic
1150412875 17:64961604-64961626 AAACCAAAATTAGCCAGGTGTGG + Intergenic
1150798962 17:68263623-68263645 AAACCAAAATTAGCCAGGTGTGG - Intronic
1151650533 17:75466072-75466094 ACAGCAACTTTAGCCAGGTCTGG - Intronic
1152110336 17:78354178-78354200 GTACAAAATTTAGCCAGGTGTGG + Intergenic
1152397396 17:80042272-80042294 TACCGAATTTTAGCCAGGTGTGG - Intronic
1155143893 18:23067929-23067951 GAAAAATTTTTAGCCAGGTGTGG - Intergenic
1157049425 18:44144589-44144611 GTACAAATATTAGCCAGGTGTGG + Intergenic
1157511010 18:48274669-48274691 GAACCAAATTCTGCCAAGTCTGG + Intronic
1158849955 18:61485781-61485803 AAACCCATTTTGGCCAGGTGCGG + Intronic
1160224224 18:76999607-76999629 GAACAAAAATTAGCCAGGTATGG - Intronic
1161697324 19:5776620-5776642 GAGCCAGTTTGAGCCAGCTCTGG - Intronic
1162271426 19:9619099-9619121 AAACAAAAATTAGCCAGGTCTGG + Intronic
1162702639 19:12529313-12529335 AAACAAATTTTGGCCAGGCCTGG + Intronic
1163048000 19:14659188-14659210 AAAAAAAATTTAGCCAGGTCTGG - Intronic
1163466705 19:17472006-17472028 GGACCCCTTTTAGCCAGGGCAGG + Intronic
1163988287 19:20972854-20972876 GAAACATTTTTGGCCAGGTGCGG + Intergenic
1164114129 19:22200672-22200694 CAACATATTTTAGCCAGGTGTGG - Intergenic
1167047912 19:47061968-47061990 AAAACAAATTTAGCCAGGTGTGG - Intergenic
1167113854 19:47477296-47477318 GAAGCAACTATAGCCAGCTCTGG - Intronic
1168521984 19:57058823-57058845 GAAAGAAATTTAGCCAGGTATGG - Intergenic
927515055 2:23667443-23667465 GAACCAATGTGAGACAGGACAGG + Intronic
927675815 2:25105306-25105328 AAACAAATATTAGCCAGGTGTGG - Intronic
927962067 2:27247072-27247094 GAACAAAAATTAGCCAGGTGTGG - Intergenic
929308896 2:40399489-40399511 GAAGGAATTTTATGCAGGTCTGG + Intronic
930481444 2:51952849-51952871 TGACCCATTTTAGCCATGTCTGG + Intergenic
931447164 2:62336374-62336396 AAACCTATCTTAGCCAGGTGGGG + Intergenic
938060103 2:128247493-128247515 AAACAAATATTAGCCAGGTATGG - Intronic
940608360 2:155957727-155957749 AAAAAAAATTTAGCCAGGTCTGG - Intergenic
941954537 2:171191276-171191298 GAAGCAATCTTAGCCAGGAGTGG + Intronic
942005194 2:171691750-171691772 GAACCCATTTTTGCCAGTTATGG - Intronic
943456185 2:188110477-188110499 AAAACAAAATTAGCCAGGTCTGG + Intergenic
946678754 2:222190746-222190768 GCACCAATTTTAGCCCTGTAAGG - Intergenic
947201649 2:227619547-227619569 CAACAAATATTAGCCAGGTACGG - Intronic
947653311 2:231805796-231805818 AAAAAAATTTTAGCCAGGTATGG - Intronic
948960263 2:241329278-241329300 GAAACAAAATTAGCCAGGTGTGG - Intronic
1170647945 20:18213364-18213386 AAACCATTTTTCCCCAGGTCAGG - Intergenic
1171796305 20:29569149-29569171 GAACCGGTGTTAGCCAGGTGTGG - Intergenic
1172052557 20:32129738-32129760 GAACAAAAATTAGCCAGGTGTGG - Intronic
1172796259 20:37540819-37540841 AAAACAATATTAGCCAGGTGTGG + Intergenic
1175607374 20:60322098-60322120 GTACAAAATTTAGCCAGGTGTGG + Intergenic
1175624277 20:60477420-60477442 GAAAAAAATTTAGCCAGGCCTGG - Intergenic
1175878290 20:62241346-62241368 GACCCAAAATTAGCCAGGTGTGG - Intronic
1179140663 21:38722307-38722329 GAAGCAAAATTAGCCAGGTGTGG - Intergenic
1179485603 21:41708449-41708471 TAAACAAATTTAGCCAGGTTTGG - Intergenic
1180881966 22:19210559-19210581 AAACCATTTTTTGGCAGGTCAGG + Intronic
1182243291 22:28934660-28934682 GTACAAATATTAGCCAGGTGTGG + Intronic
1183431928 22:37771230-37771252 GAAACAAGTTCAGCCAGGACTGG - Intronic
1183696065 22:39423126-39423148 CAACCAAAATTAGCCAGGTGTGG - Intronic
1184121678 22:42454765-42454787 GTACAAAATTTAGCCAGGTGTGG - Intergenic
1184953036 22:47859599-47859621 GAAAAAATTTTATCCAGGCCAGG + Intergenic
1185005540 22:48274522-48274544 AAAAAAATTTTAGCCAGGTATGG + Intergenic
949461209 3:4296820-4296842 TAAACAATTTTAGCCAGGAAAGG - Intronic
951858958 3:27228991-27229013 GAACCAGTTGTAGCTAGGTCAGG - Intronic
952974914 3:38685533-38685555 GAGCCAATATGAGCCAGCTCTGG - Intergenic
953476345 3:43209024-43209046 GCACCCATTTTGGCCAGGTGCGG + Intergenic
956135365 3:66093134-66093156 TAAACAATATTAGCCAGGTATGG + Intergenic
959072990 3:101720498-101720520 AAACCAAAATTAGCCAGGTGTGG + Intergenic
959211608 3:103390797-103390819 AAACAAAAATTAGCCAGGTCGGG - Intergenic
960119858 3:113936852-113936874 GGTCCAATTTTAGCCAGGTGTGG - Intronic
961610735 3:128135375-128135397 GAACAAAAATTAGCCAGGTGTGG + Intronic
963155363 3:142090714-142090736 GTACAAATATTAGCCAGGTGTGG - Intronic
963201737 3:142593113-142593135 AAACCAAAATTAGCCAGGTGTGG - Intergenic
963503510 3:146158089-146158111 ACACAAATTTTATCCAGGTCTGG + Intronic
963590817 3:147256207-147256229 CAGACAATTTTAGGCAGGTCAGG - Intergenic
963808811 3:149754326-149754348 GAACCAAGTTAGGCCAGGTATGG + Intergenic
967151734 3:186657542-186657564 GTACAAATTTTAGCCAGGCGTGG + Intergenic
970766014 4:19550003-19550025 GAACCAATTCTGGCCGGGTGTGG + Intergenic
973017111 4:45154208-45154230 GTACAAAATTTAGCCAGGTGTGG - Intergenic
974001922 4:56520291-56520313 GATCCCATTGTAGCCAGGTGCGG - Intronic
975119724 4:70715426-70715448 AAACAAAAGTTAGCCAGGTCCGG + Intronic
975552996 4:75632031-75632053 GAAACAATTTCAGCCAGATGCGG + Intergenic
979564397 4:122137769-122137791 AAACCAATCATAACCAGGTCAGG - Intergenic
981435545 4:144716959-144716981 GAATCATTTGTAGCAAGGTCTGG - Intronic
982197440 4:152930520-152930542 CCTTCAATTTTAGCCAGGTCAGG + Intergenic
982506005 4:156218780-156218802 GGACCCATTTTAGCCATGGCTGG - Intergenic
983511293 4:168612002-168612024 GTACAAATATTAGCCAGGTGTGG + Intronic
983640962 4:169943506-169943528 GAACCAATGTGGGCGAGGTCTGG - Intergenic
990311148 5:54540025-54540047 GACTCATTTTTAGCCAGGTGTGG - Intronic
990315266 5:54577430-54577452 GTACAAATTAAAGCCAGGTCAGG + Intergenic
991771317 5:70043612-70043634 AAACCAAAATTAGCCAGGTGTGG + Intergenic
991850609 5:70919029-70919051 AAACCAAAATTAGCCAGGTGTGG + Intergenic
992498044 5:77312397-77312419 AAAACAATTTGAGCCAGGCCGGG - Intronic
993137640 5:83990099-83990121 GAACCCAATAAAGCCAGGTCTGG + Intronic
993367957 5:87056067-87056089 GAACAAAAATTAGCCAGGTGAGG + Intergenic
994204892 5:97023542-97023564 AAAGAAATTTTAGCCAGGTATGG - Intronic
996079874 5:119245830-119245852 GAACCAATCTAGGCCAGGTGCGG - Intronic
996699879 5:126439607-126439629 CAATCAATTTTGGCCAGGTGCGG - Intronic
996947249 5:129085138-129085160 GAAACACTTCTAGCCAGGTGTGG + Intergenic
997882656 5:137604181-137604203 GAACCAAATTCTGCCAGGCCAGG + Intergenic
1000301436 5:159960192-159960214 GAAAGAATTTGAGCCAGGCCTGG + Intronic
1001769843 5:174285691-174285713 AAACCAATGTTAACCAGTTCAGG + Intergenic
1002345412 5:178544932-178544954 TAACAAAATTTAGCCAGGTGTGG + Intronic
1002788517 6:422048-422070 TAACAAATATTAGCCAGGTGTGG - Intergenic
1005732080 6:28707627-28707649 GAAGCTATTTTAGCCAGGCACGG + Intergenic
1006747302 6:36352323-36352345 GAGTGAATTTTAGCCAGGCCTGG - Intergenic
1006780449 6:36628856-36628878 AAACCAAAATTAGCCAGGTGTGG + Intergenic
1007145126 6:39621873-39621895 GAACCTATTTCAGCCAGGCGTGG + Intronic
1007153404 6:39718072-39718094 GAAACAAAATTAGCCAGGTGTGG + Intronic
1008630341 6:53358620-53358642 AAACTGATTTTAGCCAGGTATGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010717852 6:79250424-79250446 GAACCAATTTTAGCCCTGTTGGG - Intergenic
1011265335 6:85512112-85512134 GAACCAACTCTAGCCAGCCCTGG - Intronic
1011696683 6:89919327-89919349 AAACGAAATGTAGCCAGGTCTGG - Intergenic
1014044456 6:116869115-116869137 TCACCAATTTAAGCCAGGTTTGG + Intergenic
1014721099 6:124919649-124919671 GAACCAGTTTTAGAATGGTCAGG - Intergenic
1015162491 6:130168958-130168980 TAAACAAAATTAGCCAGGTCTGG - Intronic
1016505188 6:144771401-144771423 TAATAAATTTTAGCCAGGTGTGG - Intronic
1025732054 7:64115887-64115909 AAAAAAATTTTAGCCAGGTGTGG - Intronic
1026401407 7:70017338-70017360 GAACCAAGTTTAGCTTGTTCTGG + Intronic
1026812621 7:73481359-73481381 CAAAAAATTTTAGCCAGGTGCGG + Intronic
1028171179 7:87598890-87598912 TAGCTAATTTCAGCCAGGTCTGG - Intronic
1030129546 7:106186592-106186614 ACACCAAAATTAGCCAGGTCTGG - Intergenic
1031955300 7:127936697-127936719 AAAACAATATTAGCCAGGTGTGG - Intronic
1033358787 7:140623157-140623179 AAACCAAAATTAGCCAGGTGTGG + Intronic
1034904287 7:154930195-154930217 AAACCAATTTCAGCCAGGCATGG - Intronic
1035172870 7:157029391-157029413 GAAACAATTATGGCCAGGTGTGG - Intergenic
1038329358 8:26595871-26595893 GACCCATTATTAGCCAGTTCTGG + Intronic
1040698523 8:50033277-50033299 GTACAAAATTTAGCCAGGTGTGG - Intronic
1041839593 8:62253412-62253434 CAAAAAATTTTAGCCAGGTGTGG + Intronic
1045886699 8:107107058-107107080 GAACCAATTTTGGCCCTGTTGGG + Intergenic
1046069741 8:109236010-109236032 TAACAAATATTAGCCAGGTATGG - Intergenic
1051485958 9:17608301-17608323 GTACAAAATTTAGCCAGGTGTGG - Intronic
1052684314 9:31735010-31735032 GAAACAATGATAGCCAGGCCAGG - Intergenic
1053789717 9:41678273-41678295 GAACCGGTGTTAGCCAGGTGTGG + Intergenic
1054155427 9:61636480-61636502 GAACCGGTGTTAGCCAGGTGTGG - Intergenic
1054178055 9:61889963-61889985 GAACCGGTGTTAGCCAGGTGTGG + Intergenic
1054475213 9:65567591-65567613 GAACCGGTGTTAGCCAGGTGTGG - Intergenic
1054659474 9:67690861-67690883 GAACCGGTGTTAGCCAGGTGTGG - Intergenic
1055896755 9:81186244-81186266 AAACCAAATTTAGCCAGGTGCGG - Intergenic
1056295383 9:85188100-85188122 AGAACAATTTTACCCAGGTCTGG + Intergenic
1060733292 9:126051088-126051110 GATCCCATTTTGGCCAGGTGCGG + Intergenic
1061600069 9:131662822-131662844 GAACAAAACTTAGCCAGGGCTGG - Intronic
1187321596 X:18243361-18243383 AAACTAAATTTAGCCAGGTATGG - Intronic
1189753908 X:44251443-44251465 CAAAAAAGTTTAGCCAGGTCCGG + Intronic
1190383946 X:49866150-49866172 GAAACAAAATTAGCCAGGTGTGG - Intergenic
1192374026 X:70540922-70540944 GAACCAATCTTGGCCAGGTGTGG + Intronic
1197781045 X:130160745-130160767 AAAGAAATTTTAGCCAGGGCAGG + Intronic
1199805105 X:151291755-151291777 AAACAAAATTTAGCCAGGTGTGG + Intergenic
1202046625 Y:20742215-20742237 GGACCATTTTTGGCCAGGTGTGG + Intergenic