ID: 903164382

View in Genome Browser
Species Human (GRCh38)
Location 1:21510114-21510136
Sequence AGAGCTTTGCCCCACAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164382_903164388 17 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164388 1:21510154-21510176 AGGAGCCTGCCGCCCCCTTTAGG 0: 1
1: 0
2: 0
3: 5
4: 117
903164382_903164394 30 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164382_903164384 -3 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164384 1:21510134-21510156 TCTGGAGCCCGCGAAGCCGAAGG 0: 1
1: 0
2: 0
3: 8
4: 130
903164382_903164391 27 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164382 Original CRISPR AGAGCTTTGCCCCACAGCTG CGG (reversed) Intronic