ID: 903164385

View in Genome Browser
Species Human (GRCh38)
Location 1:21510141-21510163
Sequence GCAGGCTCCTTCGGCTTCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164385_903164396 4 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70
903164385_903164399 14 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164385_903164398 13 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164398 1:21510177-21510199 CTTTGCGAGGTGGGCCTCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 167
903164385_903164391 0 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164385_903164388 -10 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164388 1:21510154-21510176 AGGAGCCTGCCGCCCCCTTTAGG 0: 1
1: 0
2: 0
3: 5
4: 117
903164385_903164394 3 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164385 Original CRISPR GCAGGCTCCTTCGGCTTCGC GGG (reversed) Intronic